9o0g

CryoEM structure of M. mazei topoisomerase VI(A-E342Q)-minicircle DNA complex in cleavage state

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Type 2 DNA topoisomerase 6 subunit A

Methanosarcina mazei Go1

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 4 DNA 4	Type 2 DNA topoisomerase 6 subunit B × 2 （Q8PUB8） Minicircle DNA sequence × 1 Minicircle DNA sequence × 1 Minicircle DNA sequence × 1 Minicircle DNA sequence × 1 CALCIUM ION × 4 PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2 POTASSIUM ION × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	TOP6A_METMA
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–369； UniProt 1–369 Author chain C； PDBConstruct 1–369； UniProt 1–369

Type 2 DNA topoisomerase 6 subunit B

Methanosarcina mazei Go1

UniProt Q8PUB8

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 4 DNA 4	Type 2 DNA topoisomerase 6 subunit A × 2 （Q8PUB7） Minicircle DNA sequence × 1 Minicircle DNA sequence × 1 Minicircle DNA sequence × 1 Minicircle DNA sequence × 1 CALCIUM ION × 4 PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2 POTASSIUM ION × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	TOP6B_METMA
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–621； UniProt 1–621 Author chain D； PDBConstruct 1–621； UniProt 1–621

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9o0g
Deposition date deposition_date	2025-04-02
Structure title title	CryoEM structure of M. mazei topoisomerase VI(A-E342Q)-minicircle DNA complex in cleavage state
Keywords keywords	TOPRIM, GHKL, minicircle DNA, Spo11, ISOMERASE-DNA complex; ISOMERASE/DNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9o0g__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9o0g__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9o0g__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	49.63 Å
Rg (electron density)	49.02 Å
Total Rg	49.24 Å
Atom count	35292
Residues	2076
Excluded volume	317110 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9o0g__assembly_1__model_1`	octameric （8）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (9)

Entity 1 Entity 1 polymer

Description description	Type 2 DNA topoisomerase 6 subunit A
Molecular weight formula_weight	42178.3 kDa
EC 编号 ec_number	5.6.2.2
Mutation mutation	E342Q
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,C
Atom count atom_count	35292

MEGEKGSKTRKGDALAREKLLEIAEKIYNQFEEEVVPSVSLPSRTKANLEYSDESDVWVYGDRESERSAKTVKGAFQLLKTTYATDFLINEHLARNRGSTLRELYYISEGWDYAKFKEQGESDRLIEDLEILTSLQREYFHMRPEEDGATMFGPIEITEQTKRGERNIHCQKDVGEGGYQIPFNVENIEFQKHDASMIIAIETGGMYARLMENGFDEAYNAILVHLKGQPARSTRRIIKRMNEELGIPVAVFTDGDPWSYRIYASVAYGAIKSAHLSEFMATPAAKFLGLQPSDIVEYELSTDKLTEQDVSALRSELSDPRFESDYWKEQIQLQLDIGKKAQQQAFAGKGLDFVTEVYLPNRLKEMGMI

Source Source

Source organism organism	Methanosarcina mazei Go1
NCBI taxonomy ID ncbi_taxonomy_id	192952
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	Type 2 DNA topoisomerase 6 subunit B
Molecular weight formula_weight	68853.4 kDa
EC 编号 ec_number	5.6.2.2
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B,D

METPIAEELAKKQKSISVAEFFEKNRQILGFDSAPRSLITTVKEAVDNALDACEEAGILPDILVQVERTGPDYVTVIIEDNGPGIVREQIPKVFAKLLYGSRFHALKQSRGQQGIGISAAVLYAQMTAGRHTKILSKTSPTAPAHYYELMINTSTNEPDILVDEVRDWFRPHGTQIELEMRAAYVKGRRQSIYEYLKATAIVNPHARITLIDPDGNEEVFERATDKMPEPAEEILPHPEGIELGTLMKMLHYTERQKLAPFLRYSFCKIGLLTAEEICKAAGLDPEIDPHALGRHEARKLIEAFEKVKIMAPPTDCLSPIGEDLIYRGLEKETTVDFIATSTRKPAVYSGNPFVVEVGMAYGGNLPKEEKISIMRFANRVPLLYQQGGCVTTHAVEDIKWKQYGLNQPGGGIPVGPVILLIHVASINVPFTSESKDAIADIPVIKEEIDLAIKEVARKLKHYLSKQSNLKKRREKEIIITKVLPKLAAKVAHVLEKDVPDINPVVAKIMGNLLVHRVIKNNGDGTVDVAIKVKNFGTSAYSFRVHEMLPCKVSGAKPEPKVVTMGNDYDYVWDISASAGSSKVLSYKIESASEEELQKLPQLIVEGIEEELVTGAKAFKGV

Source Source

Source organism organism	Methanosarcina mazei Go1
NCBI taxonomy ID ncbi_taxonomy_id	192952
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 3 Entity 3 polymer

Description description	Minicircle DNA sequence
Molecular weight formula_weight	10781.9 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F

AGGTTACCCCAGTTGGGGCGGGCCCCTTGTACAGC

Source Source

Source organism organism	unidentified
NCBI taxonomy ID ncbi_taxonomy_id	32644
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 polymer

Description description	Minicircle DNA sequence
Molecular weight formula_weight	12011.7 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	G

TCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAAC

Source Source

Source organism organism	unidentified
NCBI taxonomy ID ncbi_taxonomy_id	32644
Host organism host_organism	Escherichia coli

Entity 5 Entity 5 polymer

Description description	Minicircle DNA sequence
Molecular weight formula_weight	11360.3 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	H

GTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGAC

Source Source

Source organism organism	unidentified
NCBI taxonomy ID ncbi_taxonomy_id	32644
Host organism host_organism	Escherichia coli

Entity 6 Entity 6 polymer

Description description	Minicircle DNA sequence
Molecular weight formula_weight	11402.3 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	I

GAGCTGTACAAGGGGCCCGCCCCAACTGGGGTAACCT

Source Source

Source organism organism	unidentified
NCBI taxonomy ID ncbi_taxonomy_id	32644
Host organism host_organism	Escherichia coli

Entity 7 Entity 7 non-polymer

Description description	CALCIUM ION
Molecular weight formula_weight	40.1 kDa
Source method src_method	syn
Copy count entity_count	4

Entity 8 Entity 8 non-polymer

Description description	PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER
Molecular weight formula_weight	506.2 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 9 Entity 9 non-polymer

Description description	POTASSIUM ION
Molecular weight formula_weight	39.1 kDa
Source method src_method	syn
Copy count entity_count	2

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	triclinic

Resolution resolution	2.50 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	329731

CryoEM structure of M. mazei topoisomerase VI(A-E342Q)-minicircle DNA complex in cleavage state

1. Protein Identity and Related Structures Protein Identity & Related Structures

Type 2 DNA topoisomerase 6 subunit A

State in the Current Structure

Other States of the Same Protein in the Database

Type 2 DNA topoisomerase 6 subunit B

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9o0g__assembly_1__model_1

9o0g__assembly_1__model_1 | I(q)

9o0g__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (9)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 polymer

Polymer Polymer

Source Source

Entity 6 Entity 6 polymer

Polymer Polymer

Source Source

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 non-polymer

Entity 9 Entity 9 non-polymer

7. Citations (1)

CryoEM structure of M. mazei topoisomerase VI(A-E342Q)-minicircle DNA complex in cleavage state

1. Protein Identity and Related Structures Protein Identity & Related Structures

Type 2 DNA topoisomerase 6 subunit A

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Type 2 DNA topoisomerase 6 subunit B

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9o0g__assembly_1__model_1

9o0g__assembly_1__model_1 | I(q)

9o0g__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (9)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 polymer

Polymer Polymer

Source Source

Entity 6 Entity 6 polymer

Polymer Polymer

Source Source

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 non-polymer

Entity 9 Entity 9 non-polymer

7. Citations (1)