← Back to search

9q7z

One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence

Method: X-RAY DIFFRACTION D_max: 106.4 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9q7z
deposition_date	2025-08-25
last_revision	2025-09-10
title	One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence
keywords	meganuclease, structure prediction, protein engineering, DNA BINDING PROTEIN-DNA complex, DNA BINDING PROTEIN; DNA BINDING PROTEIN
method	X-RAY DIFFRACTION

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	32.75 Å
rg_electron	31.86 Å
i0	188404000.00
molecular_weight	86885.0 kDa
excluded_volume	98645 Å³
envelope_volume	142390 Å³
shell_volume	37236 Å³
envelope_diameter	114.0 Å
shell_rg	38.64 Å
envelope_rg	31.50 Å
shape_rg	31.83 Å
total_rg	32.41 Å
total_atoms	6021
n_residues	682
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	106.4 Å
rg_real	32.70 Å
rg_real_error	0.96 Å
i0_real	1.8840e+08
i0_real_error	3.0760e+06
rg_reciprocal	32.72 Å
i0_reciprocal	188400000.0000
total_estimate	0.8924
solution_quality	GOOD a GOOD solution
n_peaks	2
r_peak_primary	44.4 Å
skewness	0.228
kurtosis	-0.469
angular_range	— – 0.2400 Å⁻¹
current_alpha	0.0000
highest_alpha	22940000.0000
n_real_points	49
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.913; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.983; Smooth: 0.875

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (5)

Entity 1 polymer

description	eI-OnuI_P456_CGG
formula_weight	34388.7 kDa
src_method	man
entity_count	2

Polymer

type	polypeptide(L)
strand_id	A,D
atom_count	6030

MASSRRESINPWILTGFADAEGSFLLRIRNNNKSSVGYSTELGFQITLHNKDKSILENIQSTWKVGVIANSGDNAVSLKVTRFEDLKVIIDHFEKYPLITQKLGDYKLFKQAFSVMENKEHLKENGIKELVRIKAKLNWGLTDELKKAFPENISKERSLINKNIPNFKWLAGFTSGEGSFGVNLIKSKSKLGVQVQLRFRITQHIKDKNLMNSLITYLGCGYIAETNKSEFSWLQFVVTKFSDINDKIIPVFQENTLIGVKLEDFEDWCKVAKLIEEKKHLTESGLDEIKKIKLNMNKGR

Source

organism	synthetic construct
ncbi_taxonomy_id	32630
host_organism	Escherichia coli

Entity 2 polymer

description	DNA (26-MER)
formula_weight	7975.1 kDa
src_method	syn
entity_count	2

Polymer

type	polydeoxyribonucleotide
strand_id	B,E

GGGTTTCCACTTATTCACGGTTTTAG

Entity 3 polymer

description	DNA (26-MER)
formula_weight	7998.2 kDa
src_method	syn
entity_count	2

Polymer

type	polydeoxyribonucleotide
strand_id	C,F

CCTAAAACCGTGAATAAGTGGAAACC

Entity 4 non-polymer

description	CALCIUM ION
formula_weight	40.1 kDa
src_method	syn
entity_count	2

Entity 5 water

description	water
formula_weight	18.0 kDa
src_method	nat
entity_count	9

▶

6. Citations (1)

▶

length_a	327.795 Å
length_b	40.472 Å
length_c	78.235 Å
angle_alpha	90.00 °
angle_beta	94.01 °
angle_gamma	90.00 °
z_pdb	8

space_group	C 1 2 1
int_tables_number	5
crystal_system	—

resolution	3.319 Å
resolution_low	40.874 Å
r_factor	0.2440
r_work	0.2394
r_free	0.2859

fit	/app/data/saxs_computation/q7/9q7z/9q7z.fit
pddf	/app/data/pr_computation/q7/9q7z/9q7z.pr.out
profile	/app/data/saxs_computation/q7/9q7z/9q7z.dat

One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

Refinement

Diffraction

5. Entities & Polymer Info (5)

Entity 1 polymer

Polymer

Source

Entity 2 polymer

Polymer

Entity 3 polymer

Polymer

Entity 4 non-polymer

Entity 5 water

6. Citations (1)

7. Files & Curves (10)

Files (7)

Curves (3)