← Back to search

9qu6

Cryo-EM structure of Oceanobacillus iheyensis group II intron domains D1-D5

Method: ELECTRON MICROSCOPY D_max: 108.0 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9qu6
deposition_date	2025-04-10
title	Cryo-EM structure of Oceanobacillus iheyensis group II intron domains D1-D5
keywords	Ribozyme, Metalloenzymes, Splicing, Protein-free RNA cryo-EM, RNA; RNA
method	ELECTRON MICROSCOPY

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	33.24 Å
rg_electron	32.90 Å
i0	500247000.00
molecular_weight	103560.0 kDa
excluded_volume	96286 Å³
envelope_volume	161790 Å³
shell_volume	41888 Å³
envelope_diameter	113.3 Å
shell_rg	38.97 Å
envelope_rg	32.32 Å
shape_rg	32.85 Å
total_rg	33.24 Å
total_atoms	6835
n_residues	317
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	108.0 Å
rg_real	33.17 Å
rg_real_error	0.62 Å
i0_real	5.0020e+08
i0_real_error	8.3400e+06
rg_reciprocal	33.20 Å
i0_reciprocal	500300000.0000
total_estimate	0.8971
solution_quality	GOOD a GOOD solution
n_peaks	1
r_peak_primary	38.3 Å
skewness	0.275
kurtosis	-0.416
angular_range	— – 0.2400 Å⁻¹
current_alpha	0.0001
highest_alpha	20780000.0000
n_real_points	49
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.909; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.999; Smooth: 0.932

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (4)

Entity 1 polymer

description	Group IIC Intron
formula_weight	128549.1 kDa
src_method	syn
entity_count	1

Polymer

type	polyribonucleotide
strand_id	A
atom_count	6835

GUUAUGUGUGCCCGGCAUGGGUGCAGUCUAUAGGGUGAGAGUCCCGAACUGUGAAGGCAGAAGUAACAGUUAGCCUAACGCAAGGGUGUCCGUGGCGACAUGGAAUCUGAAGGAAGCGGACGGCAAACCUUCGGUCUGAGGAACACGAACUUCAUAUGAGGCUAGGUAUCAAUGGAUGAGUUUGCAUAACAAAACAAAGUCCUUUCUGCCAAAGUUGGUACAGAGUAAAUGAAGCAGAUUGAUGAAGGGAAAGACUGCAUUCUUACCCGGGGAGGUCUGGAAACAGAAGUCAGCAGAAGUCAUAGUACCCUGUUCGCAGGGGAAGGACGGAACAAGUAUGGCGUUCGCGCCUAAGCUUGAACCGCCGUAUACCGAACGGUACGUACGGUGGUGUGG

Entity 2 polymer

description	;Group IIC Intron 5'-exon ;
formula_weight	1548.0 kDa
src_method	syn
entity_count	1

Polymer

type	polyribonucleotide
strand_id	B

GUUAU

Entity 3 non-polymer

description	MAGNESIUM ION
formula_weight	24.3 kDa
src_method	syn
entity_count	5

Entity 4 non-polymer

description	POTASSIUM ION
formula_weight	39.1 kDa
src_method	syn
entity_count	1

▶

6. Citations (1)

▶

length_a	1.000 Å
length_b	1.000 Å
length_c	1.000 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	90.00 °
z_pdb	—

space_group	P 1
int_tables_number	1
crystal_system	triclinic

resolution	3.20 Å
resolution_method	—
num_particles	55181

fit	/app/data/saxs_computation/qu/9qu6/9qu6.fit
pddf	/app/data/pr_computation/qu/9qu6/9qu6.pr.out
profile	/app/data/saxs_computation/qu/9qu6/9qu6.dat

Cryo-EM structure of Oceanobacillus iheyensis group II intron domains D1-D5

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

EM 3D

5. Entities & Polymer Info (4)

Entity 1 polymer

Polymer

Entity 2 polymer

Polymer

Entity 3 non-polymer

Entity 4 non-polymer

6. Citations (1)

7. Files & Curves (10)

Files (7)

Curves (3)