← Back to search

9qu7

Cryo-EM structure of Oceanobacillus iheyensis group II intron domains D1-D5

Method: ELECTRON MICROSCOPY D_max: 103.8 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9qu7
deposition_date	2025-04-10
title	Cryo-EM structure of Oceanobacillus iheyensis group II intron domains D1-D5
keywords	Ribozyme, Metalloenzymes, Splicing, Protein-free RNA cryo-EM, RNA; RNA
method	ELECTRON MICROSCOPY

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	32.31 Å
rg_electron	31.96 Å
i0	452917000.00
molecular_weight	98878.0 kDa
excluded_volume	92215 Å³
envelope_volume	148650 Å³
shell_volume	39802 Å³
envelope_diameter	111.1 Å
shell_rg	37.84 Å
envelope_rg	31.41 Å
shape_rg	31.92 Å
total_rg	32.30 Å
total_atoms	6514
n_residues	302
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	103.8 Å
rg_real	32.26 Å
rg_real_error	0.81 Å
i0_real	4.5290e+08
i0_real_error	7.6690e+06
rg_reciprocal	32.29 Å
i0_reciprocal	452900000.0000
total_estimate	0.8955
solution_quality	GOOD a GOOD solution
n_peaks	2
r_peak_primary	36.0 Å
skewness	0.291
kurtosis	-0.395
angular_range	— – 0.2450 Å⁻¹
current_alpha	0.0000
highest_alpha	16430000.0000
n_real_points	50
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.922; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 1.000; Smooth: 0.870

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (4)

Entity 1 polymer

description	Group IIC Intron
formula_weight	128549.1 kDa
src_method	syn
entity_count	2

Polymer

type	polyribonucleotide
strand_id	A,B
atom_count	6517

GUUAUGUGUGCCCGGCAUGGGUGCAGUCUAUAGGGUGAGAGUCCCGAACUGUGAAGGCAGAAGUAACAGUUAGCCUAACGCAAGGGUGUCCGUGGCGACAUGGAAUCUGAAGGAAGCGGACGGCAAACCUUCGGUCUGAGGAACACGAACUUCAUAUGAGGCUAGGUAUCAAUGGAUGAGUUUGCAUAACAAAACAAAGUCCUUUCUGCCAAAGUUGGUACAGAGUAAAUGAAGCAGAUUGAUGAAGGGAAAGACUGCAUUCUUACCCGGGGAGGUCUGGAAACAGAAGUCAGCAGAAGUCAUAGUACCCUGUUCGCAGGGGAAGGACGGAACAAGUAUGGCGUUCGCGCCUAAGCUUGAACCGCCGUAUACCGAACGGUACGUACGGUGGUGUGG

Entity 2 non-polymer

description	MAGNESIUM ION
formula_weight	24.3 kDa
src_method	syn
entity_count	13

Entity 3 non-polymer

description	POTASSIUM ION
formula_weight	39.1 kDa
src_method	syn
entity_count	6

Entity 4 water

description	water
formula_weight	18.0 kDa
src_method	nat
entity_count	3

▶

6. Citations (1)

▶

length_a	1.000 Å
length_b	1.000 Å
length_c	1.000 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	90.00 °
z_pdb	—

space_group	P 1
int_tables_number	1
crystal_system	triclinic

resolution	2.60 Å
resolution_method	—
num_particles	881868

fit	/app/data/saxs_computation/qu/9qu7/9qu7.fit
pddf	/app/data/pr_computation/qu/9qu7/9qu7.pr.out
profile	/app/data/saxs_computation/qu/9qu7/9qu7.dat