← Back to search

9t7l

Cryo-EM structure of the PseTnsAB paired-end complex (right end) in the presence of Mg

Method: ELECTRON MICROSCOPY D_max: 143.5 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9t7l
deposition_date	2025-11-11
title	Cryo-EM structure of the PseTnsAB paired-end complex (right end) in the presence of Mg
keywords	Transposase, DNA-binding, CRISPR-associated transposon, nuclease, DNA BINDING PROTEIN; DNA BINDING PROTEIN
method	ELECTRON MICROSCOPY

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	45.39 Å
rg_electron	45.60 Å
i0	1098620000.00
molecular_weight	256290.0 kDa
excluded_volume	312770 Å³
envelope_volume	448100 Å³
shell_volume	81026 Å³
envelope_diameter	148.9 Å
shell_rg	51.16 Å
envelope_rg	44.46 Å
shape_rg	45.63 Å
total_rg	45.74 Å
total_atoms	17938
n_residues	2012
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	143.5 Å
rg_real	45.20 Å
rg_real_error	0.96 Å
i0_real	1.0990e+09
i0_real_error	1.9000e+07
rg_reciprocal	45.39 Å
i0_reciprocal	1099000000.0000
total_estimate	0.8820
solution_quality	GOOD a GOOD solution
n_peaks	1
r_peak_primary	57.4 Å
skewness	0.198
kurtosis	-0.386
angular_range	— – 0.1750 Å⁻¹
current_alpha	0.0000
highest_alpha	60640000.0000
n_real_points	36
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.903; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.988; Smooth: 0.764

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (4)

Entity 1 polymer

description	PseTnsAB artificial fusion protein
formula_weight	97719.2 kDa
src_method	man
entity_count	4

Polymer

type	polypeptide(L)
strand_id	A,B,C,D
atom_count	17938

SNMYIRNLRKPSPNKNVFKFASTKVSSVVMCESSLEFDACFHHEYNDLIESFGSQPEGFKYEFMGKSLPYTPDALISYTDKTQKYHEYKPYSKIASPLFRAEFAAKRAASLKLGIDLVLVTDRQIRVNPILNNLKLLHRYSGVYGISGIQKELLSFIHKSGVIKLNDISSQVGIPIGETRSFLFGLMHKGLVKADLGCDDLTNNPTLWATPGSGSGKRTADGSEFESPKKKRKVGSGSGGMTDFFNEFDESLVPLKPQTPTQYVKLDDANLIQRDLDTFSDTFKNQALQRYKLISTIDKKLSRGWTQRNLDPILDELFKGGDVVRPNWRTVARWRKKYIESNGDIASLADKNHKMGNRTNRIKGDDKFFDKALERFLDAKRPTIATAYQYYKDLIVIENESIVEGKIPIISYNAFNKRIKAIPPYAVAVARHGKFKADQWFAYCAAHVPPTRILERVEIDHTPLDLILLDDELLIPIGRPYLTLLIDVFSGCVLGFHLSYKSPSYVSAAKAITHAIKPKSLDALNIELQNDWPCFGKFENLVVDNGAEFWSKNLEHACQSAGINIQYNPVRKPWLKPFIERFFGVMNEYFLPELPGKTFSNILEKEEYKPEKDAIMRFSTFVEEFHRWIADVYHQDSNSRETRIPIKRWQQGFDAYPPLTMNEEEETRFSMLMRISDSRTLTRNGFKYQELMYDSTALADYRKHYPQTKETVKKLIKVDPDDISKIYVYLEELESYLEVPCTDPTGYTDGLSIYEHKTIKKINREVIRESKDSLGLAKARMAIHERVKQEQEVFIESKTKAKITAVKKQAQIADVSNTGTSTIKVSEESAAPVQKHISNDNSDDWDDDLEAFE

Source

organism	Pseudoalteromonas sp. S983
ncbi_taxonomy_id	579572
host_organism	Escherichia coli BL21(DE3)

Entity 2 polymer

description	Transposon right-end, transferred strand
formula_weight	13642.8 kDa
src_method	syn
entity_count	2

Polymer

type	polydeoxyribonucleotide
strand_id	E,G

GTCAAGGTATGGTTGCATTATGTCAAACTATGGTTGCAGCGACA

Entity 3 polymer

description	Transposon right-end, non-transferred strand
formula_weight	14711.5 kDa
src_method	syn
entity_count	2

Polymer

type	polydeoxyribonucleotide
strand_id	F,H

ATAGTGTCGCTGCAACCATAGTTTGACATAATGCAACCATACCTTGAC

Entity 4 non-polymer

description	MAGNESIUM ION
formula_weight	24.3 kDa
src_method	syn
entity_count	2

▶

6. Citations (1)

▶

length_a	1.000 Å
length_b	1.000 Å
length_c	1.000 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	90.00 °
z_pdb	—

space_group	P 1
int_tables_number	1
crystal_system	—

resolution	2.800 Å
resolution_low	— Å
r_factor	—
r_work	—
r_free	—

resolution	2.80 Å
resolution_method	—
num_particles	203418

fit	/app/data/saxs_computation/t7/9t7l/9t7l.fit
pddf	/app/data/pr_computation/t7/9t7l/9t7l.pr.out
profile	/app/data/saxs_computation/t7/9t7l/9t7l.dat

Cryo-EM structure of the PseTnsAB paired-end complex (right end) in the presence of Mg

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

Refinement

EM 3D

5. Entities & Polymer Info (4)

Entity 1 polymer

Polymer

Source

Entity 2 polymer

Polymer

Entity 3 polymer

Polymer

Entity 4 non-polymer

6. Citations (1)

7. Files & Curves (10)

Files (7)

Curves (3)