← Back to search

9v7n

Cryo-EM structures of the Azoarcus pre-tRNA(ILE) conformation a undergoing the first-step self-splicing

Method: ELECTRON MICROSCOPY D_max: 131.8 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9v7n
deposition_date	2025-05-28
title	Cryo-EM structures of the Azoarcus pre-tRNA(ILE) conformation a undergoing the first-step self-splicing
keywords	Azoarcus pre-tRNA(ILE), self-splicing, pre-1S, RNA structure, RNA; RNA
method	ELECTRON MICROSCOPY

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	37.02 Å
rg_electron	37.31 Å
i0	395558000.00
molecular_weight	92639.0 kDa
excluded_volume	86286 Å³
envelope_volume	141940 Å³
shell_volume	35401 Å³
envelope_diameter	135.2 Å
shell_rg	38.30 Å
envelope_rg	37.34 Å
shape_rg	37.26 Å
total_rg	37.43 Å
total_atoms	6109
n_residues	284
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	131.8 Å
rg_real	37.31 Å
rg_real_error	1.57 Å
i0_real	3.9560e+08
i0_real_error	6.6210e+06
rg_reciprocal	37.14 Å
i0_reciprocal	395500000.0000
total_estimate	0.8474
solution_quality	GOOD a GOOD solution
n_peaks	2
r_peak_primary	36.8 Å
skewness	0.484
kurtosis	-0.279
angular_range	— – 0.2150 Å⁻¹
current_alpha	0.0000
highest_alpha	7250000.0000
n_real_points	44
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.791; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.727; Smooth: 0.912

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (3)

Entity 1 polymer

description	RNA (284-MER)
formula_weight	91861.5 kDa
src_method	man
entity_count	3

Polymer

type	polyribonucleotide
strand_id	B,D,E
atom_count	6109

GGGCCUCUAGCUCAUGCUUGGUUAGAGCAGCGGACUCAUAUUUCGAUGUGCCUUGCGCCGGGAAACCACGCAAGGGAUGGUGUCAAAUUCGGCGAAACCUAAGCGCCCGCCCGGGCGUAUGGCAACGCCGAGCCAAGCUUCGGCGCCUGCGCCGAUGAAGGUGUAGAGACUAGACGGCACCCACCUAAGGCAAACGCUAUGGUGAAGGCAUAGUCCAGGGAGUGGCGAAAGUCACACAAACCGGAAUCCGUUGGUGCUGGGUUCGACUCCCAGGGGGCCCACCA

Source

organism	Azoarcus olearius
ncbi_taxonomy_id	418699
host_organism	in vitro transcription vector pT7-Fluc(deltai)

Entity 2 non-polymer

description	GUANOSINE
formula_weight	283.2 kDa
src_method	syn
entity_count	1

Entity 3 non-polymer

description	MAGNESIUM ION
formula_weight	24.3 kDa
src_method	syn
entity_count	6

▶

6. Citations (1)

▶

length_a	1.000 Å
length_b	1.000 Å
length_c	1.000 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	90.00 °
z_pdb	—

space_group	P 1
int_tables_number	1
crystal_system	—

resolution	3.11 Å
resolution_method	—
num_particles	105746

fit	/app/data/saxs_computation/v7/9v7n/9v7n.fit
pddf	/app/data/pr_computation/v7/9v7n/9v7n.pr.out
profile	/app/data/saxs_computation/v7/9v7n/9v7n.dat