9vtq

Target DNA-bound type I-F3 TniQ-Cascade of Vibrio parahaemolyticus in full R-loop state 1

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Type I-F CRISPR-associated protein Csy3

Vibrio parahaemolyticus RIMD 2210633

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Heteromer	Protein 10 DNA 2 RNA 1	crRNA from Vibrio parahaemolyticus × 1 Target strand DNA × 1 Non-target strand DNA × 1 CRISPR-associated protein Csy2 × 1 （Q87GC9） CRISPR-associated protein, Csy4 family × 1 （Q87GC7） TniQ × 2 （Q87GD0） MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q87GC8_VIBPA
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain A； PDBConstruct 1–347； UniProt 1–347 Author chain B； PDBConstruct 1–347； UniProt 1–347 Author chain C； PDBConstruct 1–347； UniProt 1–347 Author chain D； PDBConstruct 1–347； UniProt 1–347 Author chain E； PDBConstruct 1–347； UniProt 1–347 Author chain F； PDBConstruct 1–347； UniProt 1–347

CRISPR-associated protein Csy2

Vibrio parahaemolyticus RIMD 2210633

UniProt Q87GC9

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Heteromer	Protein 10 DNA 2 RNA 1	crRNA from Vibrio parahaemolyticus × 1 Target strand DNA × 1 Non-target strand DNA × 1 Type I-F CRISPR-associated protein Csy3 × 6 （Q87GC8） CRISPR-associated protein, Csy4 family × 1 （Q87GC7） TniQ × 2 （Q87GD0） MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q87GC9_VIBPA
Isoform	—
PDB entities	5
Chains and sequence ranges	Author chain G； PDBConstruct 1–640； UniProt 1–640

CRISPR-associated protein, Csy4 family

Vibrio parahaemolyticus RIMD 2210633

UniProt Q87GC7

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Heteromer	Protein 10 DNA 2 RNA 1	crRNA from Vibrio parahaemolyticus × 1 Target strand DNA × 1 Non-target strand DNA × 1 Type I-F CRISPR-associated protein Csy3 × 6 （Q87GC8） CRISPR-associated protein Csy2 × 1 （Q87GC9） TniQ × 2 （Q87GD0） MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q87GC7_VIBPA
Isoform	—
PDB entities	6
Chains and sequence ranges	Author chain H； PDBConstruct 1–198； UniProt 1–198

TniQ

Vibrio parahaemolyticus RIMD 2210633

UniProt Q87GD0

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Heteromer	Protein 10 DNA 2 RNA 1	crRNA from Vibrio parahaemolyticus × 1 Target strand DNA × 1 Non-target strand DNA × 1 Type I-F CRISPR-associated protein Csy3 × 6 （Q87GC8） CRISPR-associated protein Csy2 × 1 （Q87GC9） CRISPR-associated protein, Csy4 family × 1 （Q87GC7） MAGNESIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q87GD0_VIBPA
Isoform	—
PDB entities	7
Chains and sequence ranges	Author chain I； PDBConstruct 8–406； UniProt 1–399 Author chain J； PDBConstruct 8–406； UniProt 1–399

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9vtq
Deposition date deposition_date	2025-07-11
Structure title title	Target DNA-bound type I-F3 TniQ-Cascade of Vibrio parahaemolyticus in full R-loop state 1
Keywords keywords	CRISPR-associated transposon, DNA BINDING PROTEIN; DNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9vtq__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9vtq__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9vtq__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	60.82 Å
Rg (electron density)	60.63 Å
Total Rg	60.66 Å
Atom count	29928
Residues	3619
Excluded volume	523560 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9vtq__assembly_1__model_1`	13-meric （13）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Description description	crRNA from Vibrio parahaemolyticus
Molecular weight formula_weight	19405.7 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	1
Atom count atom_count	29928

CUGAUAAUGAGAUACCACAAGCUCAAGCAGAUGCUAACAGGUGAACUGCCGAAUAGGUAG

Source Source

Source organism organism	Vibrio parahaemolyticus RIMD 2210633
NCBI taxonomy ID ncbi_taxonomy_id	223926
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	Target strand DNA
Molecular weight formula_weight	30950.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	2

CTAATGGAAGTGCCTCTGTCGCAGTGATGTGCCTAGCTGAAGCACGTTGACGGAGCTGTTAGCATCTGCTTGAGCTTGTGGTATCTCGGACCTGACTGAC

Entity 3 Entity 3 polymer

Description description	Non-target strand DNA
Molecular weight formula_weight	30751.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	3

GTCAGTCAGGTCCGAGATACCACAAGCTCAAGCAGATGCTAACAGCTCCGTCAACGTGCTTCAGCTAGGCACATCACTGCGACAGAGGCACTTCCATTAG

Entity 4 Entity 4 polymer

Description description	Type I-F CRISPR-associated protein Csy3
Molecular weight formula_weight	39455.4 kDa
Source method src_method	man
Copy count entity_count	6

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D,E,F

MKLPNGLSYMKSIEASDVIFLVNWPDGRKTPLPYTSRVALGMKEGSKSAYKYDGQIDADVTAYSLAQGNPHEIDFCCVPYGAESIECEFSVSFASSLRKPFKCSDPEVKRTLVQLIKLYEEKVGWEELANRFLENICNGRWLWRNNECTYSTSIGIKPWPWEDEKAISPFHDIRKNYAGTNHFRDHKDWDNLIKLITDAFSQPNGLCIFEVSATFRLGTNAPIYPSQVFKDSVKGEKNRIYQSTDVDGESSPILGCYKTGAAIATIDDWYPDADKPIRISHYGAHREDVYCYRHPNTGKDLFTLLEKADQYLEQLQATDVLPDEMINDLHFIVANLIKGGLLQQKGT

Source Source

Source organism organism	Vibrio parahaemolyticus RIMD 2210633
NCBI taxonomy ID ncbi_taxonomy_id	223926
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 5 Entity 5 polymer

Description description	CRISPR-associated protein Csy2
Molecular weight formula_weight	73021.9 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	G

MATLAEILDNKTDDLNKDLRRAFRPLSAPVDISDTPIEALTILVNLTDRVIEQKNLLDRQKCKDKLRDEKWWANCFRTVKYRQSHNPKFPDIRANGVIRAAPVGHLPACMLSSSKLPQNSWAYANDSSQMNKSCFLTSEFIWNGDVHCLGQLLTELEHPLWNVLRKLGCYVKTAKYISKELALIPPLEINTSLVRNYLAQISLPNNEDSYISLSPVVSQSMQEDCYQVLSEHYRFSAITRFSRATNMGTLAMSCGGKFKMIRSLPPIEKYQHHHLDSVNWLTKRSVRAIRDYTESSVWVISPNKLALRKKSIIGDIKMMLSQWLRTTPTHEEKLDIRKLTERFNVDLAKTKFANRYAYDPLLTQLIYNCIGSIIHSPPQYAPKCEGNDDKYLLLPNLRISGASAMNTSVSIGIPSMMAFYGFVHAFQRNVQTANPNFKIESFAVCIHNIHVENRGLTREWVPNTKGQITAPATRDDWQCDVAVSLILRCSHYSQLIPRDFIRLLPGRIARGKVTVSISDIKHLGRCLSLADAIKAIPVETGRWLSLNNEVTLNSIQDVIDELKNNKLQTVNCIGYHRLETPCEKRGSLHGYKHAFVETILGIIKFLTISENTNPSQYFWQYHYSKQGPILLPRSVSDETS

Source Source

Source organism organism	Vibrio parahaemolyticus RIMD 2210633
NCBI taxonomy ID ncbi_taxonomy_id	223926
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 6 Entity 6 polymer

Description description	CRISPR-associated protein, Csy4 family
Molecular weight formula_weight	22919.0 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	H

MDWHYRTITFLPEYRNNEAIAAKCIKELHRFNYKYETRSIGVSFPLWGQETVGRKITFVSTNKMELDFLISRRYFVQMTKLGYFSISTTQTVPDDCSYVLFKRAHSIDKGTFAGRARELKRLERRALERGEIFDPIAYSKTTSHAFQSYHSLEEDSSSGNKFRLNIQMKERSGTVGTGKFSSYGLGNTDNSLQVVPLI

Source Source

Source organism organism	Vibrio parahaemolyticus RIMD 2210633
NCBI taxonomy ID ncbi_taxonomy_id	223926
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 7 Entity 7 polymer

Description description	TniQ
Molecular weight formula_weight	47357.1 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	I,J

GPRISEFMVQMMLLQRPKSYPDESLESFFIRVANKNGYNDVHWFLVAVKRYLLDIDPRKFQTFPTDICCINPYSSKKHSISRTHALHHLSQLTFNEPVDLLGIALNRNQMQFSPSTTALIRGAEVIPRSLLRKGAIPCCPCCLGEHGYASYRWHFSGYEYCHEHDVKLIERCSCGAIYDYRYAGLSGVCTECGENISASQENHEPKATRIASWLAGDDVKPLPDVPLSYRWGFMHWWSQISSSCKTRNNGEFLAFWEHWPNSFHKLIGKEIDFNFEYCVLSKNDLRVKDILGKILFSSIQLPDRNFRSNIILKEMFQYIETHLWDDNGKLANLRMNMLEICVLLNCSREQVTSMIEQGLLPPNRQLGKREILIVTEYAFYLGDVYCLWLSEFQSDEFNRSFYLSRW

Source Source

Source organism organism	Vibrio parahaemolyticus RIMD 2210633
NCBI taxonomy ID ncbi_taxonomy_id	223926
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 8 Entity 8 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.840 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	2.84 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	36247

Target DNA-bound type I-F3 TniQ-Cascade of Vibrio parahaemolyticus in full R-loop state 1

1. Protein Identity and Related Structures Protein Identity & Related Structures

Type I-F CRISPR-associated protein Csy3

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

CRISPR-associated protein Csy2

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

CRISPR-associated protein, Csy4 family

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

TniQ

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9vtq__assembly_1__model_1

9vtq__assembly_1__model_1 | I(q)

9vtq__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 polymer

Polymer Polymer

Source Source

Entity 6 Entity 6 polymer

Polymer Polymer

Source Source

Entity 7 Entity 7 polymer

Polymer Polymer

Source Source

Entity 8 Entity 8 non-polymer

7. Citations (1)