← Back to search

9xy5

One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence

Method: X-RAY DIFFRACTION D_max: 88.7 Å Quality: REASONABLE

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9xy5
deposition_date	2025-08-25
last_revision	2025-09-10
title	One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence
keywords	meganuclease, structure prediction, protein engineering, DNA BINDING PROTEIN-DNA complex, DNA BINDING PROTEIN; DNA BINDING PROTEIN
method	X-RAY DIFFRACTION

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	24.62 Å
rg_electron	23.59 Å
i0	53079900.00
molecular_weight	47697.0 kDa
excluded_volume	55672 Å³
envelope_volume	67853 Å³
shell_volume	24915 Å³
envelope_diameter	93.8 Å
shell_rg	30.04 Å
envelope_rg	23.98 Å
shape_rg	23.54 Å
total_rg	24.35 Å
total_atoms	3307
n_residues	342
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	88.7 Å
rg_real	24.83 Å
rg_real_error	0.85 Å
i0_real	5.3080e+07
i0_real_error	7.9920e+05
rg_reciprocal	24.78 Å
i0_reciprocal	53080000.0000
total_estimate	0.7335
solution_quality	REASONABLE a REASONABLE solution
n_peaks	3
r_peak_primary	25.3 Å
skewness	0.607
kurtosis	0.005
angular_range	— – 0.3200 Å⁻¹
current_alpha	0.0000
highest_alpha	7342000.0000
n_real_points	64
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.603; Stabil: 0.997; Sysdev: 1.000; Positv: 1.000; Valcen: 0.731; Smooth: 0.000

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (6)

Entity 1 polymer

description	eI-OnuI_P456_AGT_2
formula_weight	34519.8 kDa
src_method	man
entity_count	1

Polymer

type	polypeptide(L)
strand_id	A
atom_count	3351

MASSRRESINPWILTGFADAEGSFLLRIRNNNKSSVGYSTELGFQITLHNKDKSILENIQSTWKVGVIANSGDNAVSLKVTRFEDLKVIIDHFEKYPLITQKLGDYKLFKQAFSVMENKEHLKENGIKELVRIKAKLNWGLTDELKKAFPENISKERSLINKNIPNFKWLAGFTSGEGHFFVNLIKSKSKLGVQVQLRFRITQHIKDKNLMNSLITYLGCGYISESNKSEFSWLNFTVTKFSDINDKIIPVFQENTLIGVKLEDFEDWCKVAKLIEEKKHLTESGLDEIKKIKLNMNKGR

Source

organism	synthetic construct
ncbi_taxonomy_id	32630
host_organism	Escherichia coli

Entity 2 polymer

description	DNA (26-MER)
formula_weight	7974.1 kDa
src_method	syn
entity_count	1

Polymer

type	polydeoxyribonucleotide
strand_id	B

GGGTTTCCACTTATTCAAGTTTTTAG

Entity 3 polymer

description	DNA (26-MER)
formula_weight	7997.2 kDa
src_method	syn
entity_count	1

Polymer

type	polydeoxyribonucleotide
strand_id	C

CCTAAAAACTTGAATAAGTGGAAACC

Entity 4 non-polymer

description	CALCIUM ION
formula_weight	40.1 kDa
src_method	syn
entity_count	2

Entity 5 non-polymer

description	1,2-ETHANEDIOL
formula_weight	62.1 kDa
src_method	syn
entity_count	1

Entity 6 water

description	water
formula_weight	18.0 kDa
src_method	nat
entity_count	35

▶

6. Citations (1)

▶

length_a	39.171 Å
length_b	68.382 Å
length_c	165.541 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	90.00 °
z_pdb	4

space_group	P 21 21 21
int_tables_number	19
crystal_system	—

resolution	2.612 Å
resolution_low	42.943 Å
r_factor	0.2162
r_work	0.2104
r_free	0.2672

fit	/app/data/saxs_computation/xy/9xy5/9xy5.fit
pddf	/app/data/pr_computation/xy/9xy5/9xy5.pr.out
profile	/app/data/saxs_computation/xy/9xy5/9xy5.dat

One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

Refinement

Diffraction

5. Entities & Polymer Info (6)

Entity 1 polymer

Polymer

Source

Entity 2 polymer

Polymer

Entity 3 polymer

Polymer

Entity 4 non-polymer

Entity 5 non-polymer

Entity 6 water

6. Citations (1)

7. Files & Curves (10)

Files (7)

Curves (3)