← Back to search

9xya

One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence

Method: X-RAY DIFFRACTION D_max: 88.3 Å Quality: REASONABLE

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9xya
deposition_date	2025-08-25
last_revision	2025-09-10
title	One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence
keywords	meganuclease, structure prediction, protein engineering, DNA BINDING PROTEIN-DNA complex, DNA BINDING PROTEIN; DNA BINDING PROTEIN
method	X-RAY DIFFRACTION

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	24.85 Å
rg_electron	23.89 Å
i0	55214800.00
molecular_weight	49036.0 kDa
excluded_volume	57476 Å³
envelope_volume	70098 Å³
shell_volume	25369 Å³
envelope_diameter	94.3 Å
shell_rg	30.44 Å
envelope_rg	24.32 Å
shape_rg	23.82 Å
total_rg	24.68 Å
total_atoms	3406
n_residues	347
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	88.3 Å
rg_real	25.07 Å
rg_real_error	0.77 Å
i0_real	5.5210e+07
i0_real_error	8.6180e+05
rg_reciprocal	25.02 Å
i0_reciprocal	55210000.0000
total_estimate	0.7433
solution_quality	REASONABLE a REASONABLE solution
n_peaks	3
r_peak_primary	25.2 Å
skewness	0.593
kurtosis	-0.040
angular_range	— – 0.3200 Å⁻¹
current_alpha	0.0000
highest_alpha	7735000.0000
n_real_points	64
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.635; Stabil: 0.996; Sysdev: 1.000; Positv: 1.000; Valcen: 0.765; Smooth: 0.000

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (7)

Entity 1 polymer

description	eI-OnuI_P456_GGC
formula_weight	34436.8 kDa
src_method	man
entity_count	1

Polymer

type	polypeptide(L)
strand_id	A
atom_count	3492

MASSRRESINPWILTGFADAEGSFLLRIRNNNKSSVGYSTELGFQITLHNKDKSILENIQSTWKVGVIANSGDNAVSLKVTRFEDLKVIIDHFEKYPLITQKLGDYKLFKQAFSVMENKEHLKENGIKELVRIKAKLNWGLTDELKKAFPENISKERSLINKNIPNFKWLAGFTSGEGYFGVNLIKSKSKLGVQVQLVFKITQHIKDKNLMNSLITYLGCGYIRESNKSEFSWLNFVVTKFSDINDKIIPVFQENTLIGVKLEDFEDWCKVAKLIEEKKHLTESGLDEIKKIKLNMNKGR

Source

organism	synthetic construct
ncbi_taxonomy_id	32630
host_organism	Escherichia coli

Entity 2 polymer

description	DNA (26-MER)
formula_weight	7975.1 kDa
src_method	syn
entity_count	1

Polymer

type	polydeoxyribonucleotide
strand_id	B

GGGTTTCCACTTATTCAGGCTTTTAG

Entity 3 polymer

description	DNA (26-MER)
formula_weight	7998.2 kDa
src_method	syn
entity_count	1

Polymer

type	polydeoxyribonucleotide
strand_id	C

CCTAAAAGCCTGAATAAGTGGAAACC

Entity 4 non-polymer

description	CALCIUM ION
formula_weight	40.1 kDa
src_method	syn
entity_count	2

Entity 5 non-polymer

description	GLYCEROL
formula_weight	92.1 kDa
src_method	syn
entity_count	1

Entity 6 non-polymer

description	1,2-ETHANEDIOL
formula_weight	62.1 kDa
src_method	syn
entity_count	1

Entity 7 water

description	water
formula_weight	18.0 kDa
src_method	nat
entity_count	86

▶

6. Citations (1)

▶

length_a	39.557 Å
length_b	75.838 Å
length_c	166.799 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	90.00 °
z_pdb	4

space_group	P 21 21 21
int_tables_number	19
crystal_system	—

resolution	2.303 Å
resolution_low	44.840 Å
r_factor	0.2177
r_work	0.2127
r_free	0.2687

fit	/app/data/saxs_computation/xy/9xya/9xya.fit
pddf	/app/data/pr_computation/xy/9xya/9xya.pr.out
profile	/app/data/saxs_computation/xy/9xya/9xya.dat

One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

Refinement

Diffraction

5. Entities & Polymer Info (7)

Entity 1 polymer

Polymer

Source

Entity 2 polymer

Polymer

Entity 3 polymer

Polymer

Entity 4 non-polymer

Entity 5 non-polymer

Entity 6 non-polymer

Entity 7 water

6. Citations (1)

7. Files & Curves (10)

Files (7)

Curves (3)