SAXSdb — 9ypf

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Cmp-binding-factor 1

Staphylococcus aureus

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Homooligomer Protein × 6 RNA 1 PDB declaration: heptameric（7） Consistent with all polymer counts	Chain A； UniProt 1–313 Chain B； UniProt 1–313 Chain C； UniProt 1–313 Chain D； UniProt 1–313 Chain E； UniProt 1–313 Chain F； UniProt 1–313	Mutation：D193A	RNA × 1 MAGNESIUM ION × 12 PHOSPHATE ION × 6	ELECTRON MICROSCOPY mmCIF provides none of the parsed experimental conditions	Resolution 3.50 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9YPF	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
9O7T S. aureus YhaM D193A, 4 N-terminal domains, 2 RNA substrates Deposited 2025-04-15	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–RNA Homooligomer；Protein × 6 PDB declaration: octameric	Chain A 1–313（313 aa） Chain B 1–313（313 aa） Chain C 1–313（313 aa） Chain D 1–313（313 aa） Chain E 1–313（313 aa） Chain F 1–313（313 aa）	Mutation：D193A Mutation：D193A Mutation：D193A Mutation：D193A Mutation：D193A Mutation：D193A	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 3.26 Å
9OV1 S. aureus YhaM D193A hexamer, D3 refinement Deposited 2025-05-29	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 6 PDB declaration: hexameric	Chain A 1–313（313 aa） Chain B 1–313（313 aa） Chain C 1–313（313 aa） Chain D 1–313（313 aa） Chain E 1–313（313 aa） Chain F 1–313（313 aa）	Mutation：D193A Mutation：D193A Mutation：D193A Mutation：D193A Mutation：D193A Mutation：D193A	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 2.36 Å
9YPE S. aureus YhaM D193A hexamer, 2 NTDs, hairpin RNA substrate Deposited 2025-10-14	Different structure-quality metrics	Assembly 1 Protein–RNA Homooligomer；Protein × 6 PDB declaration: heptameric	Chain A 1–313（313 aa） Chain B 1–313（313 aa） Chain C 1–313（313 aa） Chain D 1–313（313 aa） Chain E 1–313（313 aa） Chain F 1–313（313 aa）	Mutation：D193A Mutation：D193A Mutation：D193A Mutation：D193A Mutation：D193A Mutation：D193A	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 3.20 Å

3 other PDB entries and 3 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	A0A0H2XHZ3_STAA3
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–313； UniProt 1–313 Author chain B； PDBConstruct 1–313； UniProt 1–313 Author chain C； PDBConstruct 1–313； UniProt 1–313 Author chain D； PDBConstruct 1–313； UniProt 1–313 Author chain E； PDBConstruct 1–313； UniProt 1–313 Author chain F； PDBConstruct 1–313； UniProt 1–313

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9ypf
Deposition date deposition_date	2025-10-14
Structure title title	S. aureus YhaM D193A hexamer, 3 NTDs, hairpin RNA substrate
Keywords keywords	exonuclease, translation, RNA, RNA BINDING PROTEIN, RNA BINDING PROTEIN-RNA complex; RNA BINDING PROTEIN/RNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	37.82 Å
Radius of gyration Rg (electron density) rg_electron	36.63 Å
Forward intensity I(0) i0	553603000.00
Molecular weight molecular_weight	186860.0 kDa
Excluded volume excluded_volume	232070 Å³
Envelope volume envelope_volume	314190 Å³
Hydration-shell volume shell_volume	68389 Å³
Envelope diameter envelope_diameter	118.2 Å
Shell Rg shell_rg	45.41 Å
Envelope Rg envelope_rg	35.70 Å
Shape Rg shape_rg	36.61 Å
Total Rg total_rg	37.22 Å
Total atoms total_atoms	13114
Residues n_residues	1588
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	110.8 Å
Rg (real space) rg_real	37.47 Å
Rg uncertainty (real space) rg_real_error	0.46 Å
I(0) (real space) i0_real	5.5360e+08
I(0) uncertainty (real space) i0_real_error	6.8070e+06
Rg (reciprocal space) rg_reciprocal	37.69 Å
I(0) (reciprocal space) i0_reciprocal	553700000.0000
Solution quality estimate total_estimate	0.8946
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	52.7 Å
Skewness Skewness skewness	-0.011
Kurtosis Kurtosis kurtosis	-0.522
Angular range angular_range	— – 0.2100 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	107700000.0000
Real-space data points n_real_points	43
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.935; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.966; Smooth: 0.854

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Cmp-binding-factor 1
Molecular weight formula_weight	35785.8 kDa
Mutation mutation	D193A
Source method src_method	man
Copy count entity_count	6

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D,E,F
Atom count atom_count	13114

MRNIENLNPGDSVDHFFLVHKATQGVTAQGKDYMTLHLQDKSGEIEAKFWTATKNDMATIKPEEIVHVKGDIINYRGNKQMKVNQIRLATTEDQLKTEQFVDGAPLSPAEIQEEISHYLLDIENANLQRITRHLLKKYQERFYTYPAASSHHHNFASGLSYHVLTMLRIAKSICDIYPLLNKSLLYSGIILHAIGKVRELSGPVATSYTVEGNLLGHISIASDEVVEAARELNIEGEEIMLLRHMILSHHGKLEYGSPKLPYLKEAEILCYIDNIDARMNMFEKAYKKTDKGQFTDKIFGLENRRFYNPESLD

来源 Source

来源生物 organism	Staphylococcus aureus
NCBI Class编号 ncbi_taxonomy_id	1280
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	RNA
Molecular weight formula_weight	12636.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	G

UAAAGCACUUGUGUUUUUGCACAAGUGCUUUUUUAUACUC

Entity 3 Entity 3 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	12

Entity 4 Entity 4 non-polymer

Description description	PHOSPHATE ION
Molecular weight formula_weight	95.0 kDa
Source method src_method	syn
Copy count entity_count	6

▶

8. Citations (1)

▶

Resolution resolution	3.50 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	42145

fit	/app/data/saxs_computation/yp/9ypf/9ypf.fit
pddf	/app/data/pr_computation/yp/9ypf/9ypf.pr.out
profile	/app/data/saxs_computation/yp/9ypf/9ypf.dat

S. aureus YhaM D193A hexamer, 3 NTDs, hairpin RNA substrate

1. Protein Identity and Related Structures Protein Identity & Related Structures

Cmp-binding-factor 1

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)