← Back to search

9zf2

Cryo-EM structure of RNase P RNA from Geobacillus stearothermophilus, conformer 1

Method: ELECTRON MICROSCOPY D_max: 162.7 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9zf2
deposition_date	2025-12-01
title	Cryo-EM structure of RNase P RNA from Geobacillus stearothermophilus, conformer 1
keywords	RNase P RNA, Geobacillus stearothermophilus, catalytic RNA, cryo-EM structure, conformational heterogeneity, RNA; RNA
method	ELECTRON MICROSCOPY

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	46.61 Å
rg_electron	47.03 Å
i0	846838000.00
molecular_weight	136670.0 kDa
excluded_volume	127080 Å³
envelope_volume	241200 Å³
shell_volume	46949 Å³
envelope_diameter	168.7 Å
shell_rg	45.88 Å
envelope_rg	46.11 Å
shape_rg	47.01 Å
total_rg	47.02 Å
total_atoms	8999
n_residues	417
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	162.7 Å
rg_real	46.99 Å
rg_real_error	1.68 Å
i0_real	8.4680e+08
i0_real_error	1.6370e+07
rg_reciprocal	46.62 Å
i0_reciprocal	846400000.0000
total_estimate	0.8590
solution_quality	GOOD a GOOD solution
n_peaks	1
r_peak_primary	43.1 Å
skewness	0.463
kurtosis	-0.390
angular_range	— – 0.1700 Å⁻¹
current_alpha	0.0000
highest_alpha	21130000.0000
n_real_points	35
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.821; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.938; Smooth: 0.763

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (3)

Entity 1 polymer

description	RNase P RNA
formula_weight	135304.2 kDa
src_method	man
entity_count	1

Polymer

type	polyribonucleotide
strand_id	A
atom_count	9000

GUUAAUCAUGCUCGGGUAAUCGCUGCGGCCGGUUUCGGCCGUAGAGGAAAGUCCAUGCUCGCACGGUGCUGAGAUGCCCGUAGUGUUCGUGCCUAGCGAAUCCAUAAGCUAGGGCAGCCUGGCUUCGGCUGGGCUGACGGCGGGGAAAGAACCUACGUCCGGCUGGGAUAUGGUUCGAUUACCCUGAAAGUGCCACAGUGACGGAGCUCUAAGGGAAACCUUAGAGGUGGAACGCGGUAAACCCCACGAGCGAGAAACCCAAAUGAUGGUAGGGGCACCUUCCCGAAGGAAAUGAACGGAGGGAAGGACAGGCGGCGCAUGCAGCCUGUAGAUAGAUGAUUACCGCCGGAGUACGAGGCGCAAAGCCGCUUGCAGUACGAAGGUACAGAACAUGGCUUAUAGAGCAUGAUUAACGUC

Source

organism	Geobacillus stearothermophilus
ncbi_taxonomy_id	1422
host_organism	in vitro transcription vector pT7-TP(deltai)

Entity 2 non-polymer

description	MAGNESIUM ION
formula_weight	24.3 kDa
src_method	syn
entity_count	37

Entity 3 water

description	water
formula_weight	18.0 kDa
src_method	nat
entity_count	1

▶

6. Citations (1)

▶

length_a	1.000 Å
length_b	1.000 Å
length_c	1.000 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	90.00 °
z_pdb	—

space_group	P 1
int_tables_number	1
crystal_system	—

resolution	2.900 Å
resolution_low	— Å
r_factor	—
r_work	—
r_free	—

resolution	2.90 Å
resolution_method	—
num_particles	78043

fit	/app/data/saxs_computation/zf/9zf2/9zf2.fit
pddf	/app/data/pr_computation/zf/9zf2/9zf2.pr.out
profile	/app/data/saxs_computation/zf/9zf2/9zf2.dat

Cryo-EM structure of RNase P RNA from Geobacillus stearothermophilus, conformer 1

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

Refinement

EM 3D