9zgf

The complex of HSV-1 proteins UL9 and ICP8 with forked DNA

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Major DNA-binding protein

Human alphaherpesvirus 1 strain 17

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 2 DNA 2	Replication origin-binding protein × 1 （P10193） DNA (40-MER) × 1 DNA (31-MER) × 1 ZINC ION × 1 MAGNESIUM ION × 1 PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	DNBI_HHV11
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–1196； UniProt 1–1196

Replication origin-binding protein

Human alphaherpesvirus 1 strain 17

UniProt P10193

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 2 DNA 2	Major DNA-binding protein × 1 （P04296） DNA (40-MER) × 1 DNA (31-MER) × 1 ZINC ION × 1 MAGNESIUM ION × 1 PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	OBP_HHV11
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain C； PDBConstruct 1–851； UniProt 1–851

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9zgf
Deposition date deposition_date	2025-12-02
Structure title title	The complex of HSV-1 proteins UL9 and ICP8 with forked DNA
Keywords keywords	DNA replication, protein-DNA complex, REPLICATION-DNA complex; REPLICATION/DNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9zgf__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9zgf__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9zgf__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	45.03 Å
Rg (electron density)	44.15 Å
Total Rg	44.41 Å
Atom count	15403
Residues	1896
Excluded volume	269670 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9zgf__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	Major DNA-binding protein
Molecular weight formula_weight	128486.5 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	15403

METKPKTATTIKVPPGPLGYVYARACPSEGIELLALLSARSGDSDVAVAPLVVGLTVESGFEANVAVVVGSRTTGLGGTAVSLKLTPSHYSSSVYVFHGGRHLDPSTQAPNLTRLCERARRHFGFSDYTPRPGDLKHETTGEALCERLGLDPDRALLYLVVTEGFKEAVCINNTFLHLGGSDKVTIGGAEVHRIPVYPLQLFMPDFSRVIAEPFNANHRSIGEKFTYPLPFFNRPLNRLLFEAVVGPAAVALRCRNVDAVARAAAHLAFDENHEGAALPADITFTAFEASQGKTPRGGRDGGGKGAAGGFEQRLASVMAGDAALALESIVSMAVFDEPPTDISAWPLFEGQDTAAARANAVGAYLARAAGLVGAMVFSTNSALHLTEVDDAGPADPKDHSKPSFYRFFLVPGTHVAANPQVDREGHVVPGFEGRPTAPLVGGTQEFAGEHLAMLCGFSPALLAKMLFYLERCDGAVIVGRQEMDVFRYVADSNQTDVPCNLCTFDTRHACVHTTLMRLRARHPKFASAARGAIGVFGTMNSMYSDCDVLGNYAAFSALKRADGSETARTIMQETYRAATERVMAELETLQYVDQAVPTAMGRLETIITNREALHTVVNNVRQVVDREVEQLMRNLVEGRNFKFRDGLGEANHAMSLTLDPYACGPCPLLQLLGRRSNLAVYQDLALSQCHGVFAGQSVEGRNFRNQFQPVLRRRVMDMFNNGFLSAKTLTVALSEGAAICAPSLTAGQTAPAESSFEGDVARVTLGFPKELRVKSRVLFAGASANASEAAKARVASLQSAYQKPDKRVDILLGPLGFLLKQFHAAIFPNGKPPGSNQPNPQWFWTALQRNQLPARLLSREDIETIAFIKKFSLDYGAINFINLAPNNVSELAMYYMANQILRYCDHSTYFINTLTAIIAGSRRPPSVQAAAAWSAQGGAGLEAGARALMDAVDAHPGAWTSMFASCNLLRPVMAARPMVVLGLSISKYYGMAGNDRVFQAGNWASLMGGKNACPLLIFDRTRKFVLACPRAGFVCAASSLGGGAHESSLCEQLRGIISEGGAAVASSVFVATVKSLGPRTQQLQIEDWLALLEDEYLSEEMMELTARALERGNGEWSTDAALEVAHEAEALVSQLGNAGEVFNFGDFGCEDDNATPFGGPGAPGPAFAGRKRAFHGDDPFGEGPPDKKGDLTLDML

Source Source

Source organism organism	Human alphaherpesvirus 1 strain 17
NCBI taxonomy ID ncbi_taxonomy_id	10299
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	Replication origin-binding protein
Molecular weight formula_weight	94371.7 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C

MPFVGGAESGDPLGAGRPIGDDECEQYTSSVSLARMLYGGDLAEWVPRVHPKTTIERQQHGPVTFPNASAPTARCVTVVRAPMGSGKTTALIRWLREAIHSPDTSVLVVSCRRSFTQTLATRFAESGLVDFVTYFSSTNYIMNDRPFHRLIVQVESLHRVGPNLLNNYDVLVLDEVMSTLGQLYSPTMQQLGRVDALMLRLLRICPRIIAMDATANAQLVDFLCGLRGEKNVHVVVGEYAMPGFSARRCLFLPRLGTELLQAALRPPGPPSGPSPDASPEARGATFFGELEARLGGGDNICIFSSTVSFAEIVARFCRQFTDRVLLLHSLTPLGDVTTWGQYRVVIYTTVVTVGLSFDPLHFDGMFAYVKPMNYGPDMVSVYQSLGRVRTLRKGELLIYMDGSGARSEPVFTPMLLNHVVSSCGQWPAQFSQVTNLLCRRFKGRCDASACDTSLGRGSRIYNKFRYKHYFERCTLACLSDSLNILHMLLTLNCIRVRFWGHDDTLTPKDFCLFLRGVHFDALRAQRDLRELRCRDPEASLPAQAAETEEVGLFVEKYLRSDVAPAEIVALMRNLNSLMGRTRFIYLALLEACLRVPMATRSSAIFRRIYDHYATGVIPTINVTGELELVALPPTLNVTPVWELLCLCSTMAARLHWDSAAGGSGRTFGPDDVLDLLTPHYDRYMQLVFELGHCNVTDGLLLSEEAVKRVADALSGCPPRGSVSETDHAVALFKIIWGELFGVQMAKSTQTFPGAGRVKNLTKQTIVGLLDAHHIDHSACRTHRQLYALLMAHKREFAGARFKLRVPAWGRCLRTHSSSANPNADIILEAALSELPTEAWPMMQGAVNFSTL

Source Source

Source organism organism	Human alphaherpesvirus 1 strain 17
NCBI taxonomy ID ncbi_taxonomy_id	10299
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 3 Entity 3 polymer

Description description	DNA (40-MER)
Molecular weight formula_weight	12184.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

CGAAGCGTTCGCACTTCGTCCCAATCTAACAATATCAATA

Entity 4 Entity 4 polymer

Description description	DNA (31-MER)
Molecular weight formula_weight	9579.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

ATACAATCAAGGACGAAGTGCGAACGCTTCG

Entity 5 Entity 5 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 7 Entity 7 non-polymer

Description description	PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER
Molecular weight formula_weight	523.2 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.100 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	3.10 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	411805

The complex of HSV-1 proteins UL9 and ICP8 with forked DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Major DNA-binding protein

State in the Current Structure

Other States of the Same Protein in the Database

Replication origin-binding protein

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9zgf__assembly_1__model_1

9zgf__assembly_1__model_1 | I(q)

9zgf__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

7. Citations (1)

The complex of HSV-1 proteins UL9 and ICP8 with forked DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Major DNA-binding protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Replication origin-binding protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9zgf__assembly_1__model_1

9zgf__assembly_1__model_1 | I(q)

9zgf__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

7. Citations (1)