← Back to search

9zgn

Cryo-EM structure of RNase P RNA from Geobacillus stearothermophilus, conformer 5

Method: ELECTRON MICROSCOPY D_max: 166.8 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9zgn
deposition_date	2025-12-03
title	Cryo-EM structure of RNase P RNA from Geobacillus stearothermophilus, conformer 5
keywords	RNase P RNA, Geobacillus stearothermophilus, catalytic RNA, cryo-EM structure, conformational heterogeneity, RNA; RNA
method	ELECTRON MICROSCOPY

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	47.32 Å
rg_electron	47.76 Å
i0	846575000.00
molecular_weight	136770.0 kDa
excluded_volume	127160 Å³
envelope_volume	245410 Å³
shell_volume	46772 Å³
envelope_diameter	168.5 Å
shell_rg	46.51 Å
envelope_rg	47.03 Å
shape_rg	47.76 Å
total_rg	47.74 Å
total_atoms	9003
n_residues	417
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	166.8 Å
rg_real	47.73 Å
rg_real_error	2.04 Å
i0_real	8.4660e+08
i0_real_error	1.5610e+07
rg_reciprocal	47.33 Å
i0_reciprocal	846100000.0000
total_estimate	0.8516
solution_quality	GOOD a GOOD solution
n_peaks	1
r_peak_primary	45.5 Å
skewness	0.449
kurtosis	-0.449
angular_range	— – 0.1650 Å⁻¹
current_alpha	0.0000
highest_alpha	21060000.0000
n_real_points	34
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.802; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.886; Smooth: 0.775

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (3)

Entity 1 polymer

description	RNase P RNA
formula_weight	135304.2 kDa
src_method	man
entity_count	1

Polymer

type	polyribonucleotide
strand_id	A
atom_count	9004

GUUAAUCAUGCUCGGGUAAUCGCUGCGGCCGGUUUCGGCCGUAGAGGAAAGUCCAUGCUCGCACGGUGCUGAGAUGCCCGUAGUGUUCGUGCCUAGCGAAUCCAUAAGCUAGGGCAGCCUGGCUUCGGCUGGGCUGACGGCGGGGAAAGAACCUACGUCCGGCUGGGAUAUGGUUCGAUUACCCUGAAAGUGCCACAGUGACGGAGCUCUAAGGGAAACCUUAGAGGUGGAACGCGGUAAACCCCACGAGCGAGAAACCCAAAUGAUGGUAGGGGCACCUUCCCGAAGGAAAUGAACGGAGGGAAGGACAGGCGGCGCAUGCAGCCUGUAGAUAGAUGAUUACCGCCGGAGUACGAGGCGCAAAGCCGCUUGCAGUACGAAGGUACAGAACAUGGCUUAUAGAGCAUGAUUAACGUC

Source

organism	Geobacillus stearothermophilus
ncbi_taxonomy_id	1422
host_organism	in vitro transcription vector pT7-TP(deltai)

Entity 2 non-polymer

description	MAGNESIUM ION
formula_weight	24.3 kDa
src_method	syn
entity_count	41

Entity 3 water

description	water
formula_weight	18.0 kDa
src_method	nat
entity_count	1

▶

6. Citations (1)

▶

length_a	1.000 Å
length_b	1.000 Å
length_c	1.000 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	90.00 °
z_pdb	—

space_group	P 1
int_tables_number	1
crystal_system	—

resolution	2.900 Å
resolution_low	— Å
r_factor	—
r_work	—
r_free	—

resolution	2.90 Å
resolution_method	—
num_particles	78850

fit	/app/data/saxs_computation/zg/9zgn/9zgn.fit
pddf	/app/data/pr_computation/zg/9zgn/9zgn.pr.out
profile	/app/data/saxs_computation/zg/9zgn/9zgn.dat

Cryo-EM structure of RNase P RNA from Geobacillus stearothermophilus, conformer 5

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

Refinement

EM 3D