Current Protein Identity：P69202
New Search
Difference tags compare only the current result set; every original PDB and assembly record remains separate.
Related-Structure Differences
Each row represents one biological assembly in one PDB entry; multiple monomers of the same protein are listed separately.
| PDB Entry | Assembly / Oligomeric State | Construct | Mutations and Modifications | Ligands, Ions and Non-polymers | Experimental Method | Experimental Conditions | Structure Quality |
|---|---|---|---|---|---|---|---|
| 1ADR DETERMINATION OF THE NUCLEAR MAGNETIC RESONANCE STRUCTURE OF THE DNA-BINDING DOMAIN OF THE P22 C2 REPRESSOR (1-76) IN SOLUTION AND COMPARISON WITH THE DNA-BINDING DOMAIN OF THE 434 REPRESSOR Deposited 1993-07-19 | Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric（1） Consistent with protein count |
Chain A
1–76（76 aa）
|
Not recorded | No recorded non-water small molecule | SOLUTION NMR | mmCIF provides none of the parsed conditions | Resolution not provided |
| 2R1J Crystal Structure of the P22 c2 Repressor protein in complex with the synthetic operator 9T Deposited 2007-08-22 | Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric（4） Consistent with all polymers |
Chain L
1–68（68 aa）
Chain R
1–68（68 aa）
|
Not recorded | No recorded non-water small molecule | X-RAY DIFFRACTION |
X-ray crystallization conditions
VAPOR DIFFUSION, HANGING DROP；pH 7.8；277 K；The initial crystallization solution contained 0.42 mM P22R NTD, 0.42 mM duplex d(5 TATTTAAGATATCTTAAATG3 ) -d(5 CATTTAAGATATCTTAAATA3 ), 45 mM Tris.HCl (pH 7.8), 19 mM NaCl, 1.9 mM glycerol, 11% PEG 400, 4.5 mM LiCl, 2.3mM MgCl2 and 0.91% MPD in a volume of 5.3 ul. The crystallization solution was equilibrated against a reservoir of 100 mM Tris.HCl (pH 7.8), 25% PEG 400, 10 mM LiCl, 5 mM MgCl2 and 2% MPD, VAPOR DIFFUSION, HANGING DROP, temperature 277K
|
Resolution 1.53 Å R-free 0.225 |
| 3JXB Crystal structure of the P22 c2 repressor protein in complex with synthetic operator 9C Deposited 2009-09-18 | Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric（4） Consistent with all polymers |
Chain C
2–68（67 aa）
Fragment：N-terminal domain: UNP residues 2-68
Chain D
2–68（67 aa）
Fragment：N-terminal domain: UNP residues 2-68
|
Not recorded | No recorded non-water small molecule | X-RAY DIFFRACTION |
X-ray crystallization conditions
VAPOR DIFFUSION, HANGING DROP；pH 7.8；277 K；PEG 400, NaCl, Tris-HCl, MgCl2, LiCl, pH 7.8, VAPOR DIFFUSION, HANGING DROP, temperature 277K
|
Resolution 1.67 Å R-free 0.226 |
| 3JXC Crystal structure of the P22 c2 repressor protein in complex with synthetic operator 9T in the presence of Tl+ Deposited 2009-09-18 | Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric（4） Consistent with all polymers |
Chain L
2–68（67 aa）
Fragment：N-terminal domain: UNP residues 2-68
Chain R
2–68（67 aa）
Fragment：N-terminal domain: UNP residues 2-68
|
Not recorded | TL THALLIUM (I) ION × 4 | X-RAY DIFFRACTION |
X-ray crystallization conditions
VAPOR DIFFUSION, HANGING DROP；pH 7.8；277 K；PEG 400, Thallium acetate, Tris-HCl, Magnesium acetate, pH 7.8, VAPOR DIFFUSION, HANGING DROP, temperature 277K
|
Resolution 1.90 Å R-free 0.208 |
| 3JXD Crystal structure of the P22 c2 repressor protein in complex with synthetic operator 9C in the presence of Rb+ Deposited 2009-09-18 | Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric（4） Consistent with all polymers |
Chain L
2–68（67 aa）
Fragment：N-terminal domain: UNP residues 2-68
Chain R
2–68（67 aa）
Fragment：N-terminal domain: UNP residues 2-68
|
Not recorded | RB RUBIDIUM ION × 2 | X-RAY DIFFRACTION |
X-ray crystallization conditions
VAPOR DIFFUSION, HANGING DROP；pH 7.8；277 K；Rubidium chloride, PEG 400, Tris-HCl, MgCl2, pH 7.8, VAPOR DIFFUSION, HANGING DROP, temperature 277K
|
Resolution 2.10 Å R-free 0.225 |