The following content comes directly from the SASBDB entry. Missing values are shown as “—”; SAXSdb does not infer undeclared units.
Every source field is expanded here, including empty values, list members and fields already shown above.
View the complete summary.json source
{
"code": "SASDAC9",
"status": "Published",
"type_of_curve": "Extrapolated to infinite dilution",
"angular_unit": "1/nm",
"project": {
"title": "Crystal structure of the Varkud satellite ribozyme.",
"publication": {
"title": "Crystal structure of the Varkud satellite ribozyme.",
"author_list": "Suslov NB, DasGupta S, Huang H, Fuller JR, Lilley DM, Rice PA, Piccirilli JA",
"journal": "Nat Chem Biol",
"doi": "10.1038/nchembio.1929",
"pmid": "26414446",
"published_date": "2015 Nov"
},
"status": "released",
"submitted_date": "2015-08-27",
"released_date": "2015-09-16"
},
"pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDAC9.out",
"intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDAC9.dat",
"intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDAC9_dat_img.png",
"intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDAC9_kratky_img.png",
"pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDAC9_pofr_img.png",
"intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDAC9_guinier_img.png",
"sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDAC9.sascif",
"experiment": {
"instrument": {
"detector": {
"type": null,
"name": "Pilatus3 X 2M",
"resolution": 172.0
},
"name": "Advanced Light Source (ALS)",
"city": "Berkeley, CA",
"country": "USA",
"beamline_name": "12.3.1 (SIBYLS)",
"beam_geometry": "",
"type_of_source": "X-ray synchrotron",
"point_source": null,
"line_collimation": null,
"sample_path_length": null,
"line_collimation_slitlength": null,
"line_collimation_integrationwidth": null,
"xray_energy": null,
"beam_profile_ah": null,
"beam_profile_al": null
},
"sample": {
"molecule": [
{
"long_name": "Varkud Satellite (VS) ribozyme",
"short_name": "G638A",
"sequence": "GGCGCUGUGUCGCAAUCUGCGAAGGGCGUCGUCGGCCCAAGCGGUAGUAAGCAGGGA\r\nACUCACCUCCAAUGAAACACAUUGUCGUAGCAGUUGACUACUGUUAUGUGAUUGGUAG\r\nAGGCUAAGUGACGGUAUUGGCGUAAGCCAAUACCGCAGCACAGCACAAGCCCGCUUGC\r\nGAGAUUACAGCGC",
"organism": "Neurospora",
"uniprot_code": null,
"uniprot_range_first": null,
"uniprot_range_last": null,
"oligomerization": "dimer",
"molecular_type": "RNA",
"uniprot_sequence": null,
"mw": 60.15,
"total_mw": 120.299,
"number_molecules": 2,
"complex_state": false,
"deuteration": null,
"molecule_source": "biological",
"molecule_description": null
}
],
"buffer": {
"name": "10 mM Tris 25 mM KCl 5 mM MgCl2",
"concentration_unit": "mM",
"comment": null,
"additive": "25 mM KCl and 5 mM MgCl2",
"concentration": 10.0,
"pka": null,
"ph": 7.5,
"deuteration": null
},
"purity_method": null,
"name": "Varkud Satellite (VS) ribozyme in Tris",
"ext_coefficient": null,
"contrast": null,
"specific_vol": null,
"dry_vol": null,
"absorbption": null,
"deuteration": null,
"mixture": null
},
"contributor": [
{
"affiliation": [
{
"short_name": "Uchicago",
"address": "Edward H. Levi Hall 5801 South Ellis Avenue Chicago, Illinois 60637 773.702.1234",
"full_name": "The University of Chicago",
"webpage": "http://www.uchicago.edu/"
}
],
"contributor_name": "James",
"contributor_surname": "Fuller",
"orcid": null
}
],
"concentration_method": null,
"concentration_unit": null,
"date": "2012-03-06",
"storage_temperature": null,
"cell_temperature": null,
"exposure_time": null,
"number_of_frames": 24,
"wavelength": 0.103,
"sample_detector_distance": null,
"concentration_min": 1.5,
"concentration_max": 4.5,
"sample_volume": null,
"flow_rate": null,
"s_min": 0.21,
"s_max": 3.244,
"total_exposure_time": null,
"seccolumn": null
},
"fits": [
{
"models": [
{
"model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDAC9_fit1_model1_img.png",
"software": "DAMMIN",
"pdb_link": [],
"model_title": null,
"type_of_model": "dummy",
"software_version": "",
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDAC9_fit1_model1.pdb",
"model_mw": null,
"bead_radius": 4.0,
"log": null,
"symmetry": "",
"comment": "",
"user": 76
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDAC9_fit1_fit_img.png",
"software": null,
"chi_square_value": null,
"p_value": 0.0,
"fit_residual_plot": null,
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDAC9_fit1.fit",
"fit_log": null,
"software_version": null,
"description": null
},
{
"models": [
{
"model_plot": "https://www.sasbdb.org/media/pdb_file/images/VS_final_dimer_img.png",
"software": "FoXS",
"pdb_link": [],
"model_title": null,
"type_of_model": "mix",
"software_version": "",
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDAC9_fit2_model1.pdb",
"model_mw": 122.5,
"bead_radius": 1.9,
"log": null,
"symmetry": "",
"comment": "",
"user": 76
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDAC9_fit2_fitfoxs_img.png",
"software": null,
"chi_square_value": 680.308162,
"p_value": 0.0,
"fit_residual_plot": "SASDAC9_fit2_fitfoxsresiduals_img.png",
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDAC9_fit2.dat",
"fit_log": null,
"software_version": null,
"description": null
}
],
"estimated_volume_method": null,
"pddf_software": "ATSAS GNOM",
"pddf_software_version": null,
"i0_calibration_standard": null,
"description": "SAXS data from a catalytically inactive construct support the overall conformation and dimeric state of the VS ribozyme in its x-ray crystal structure.",
"experiment_description": null,
"tags": [],
"intensity_unit": null,
"experimental_mw": 125.0,
"experimental_mw_error": null,
"guinier_i0_mw": 125.0,
"guinier_i0_mw_error": null,
"porod_mw": null,
"porod_mw_error": null,
"pddf_i0": 4491.0,
"pddf_i0_error": null,
"guinier_i0": 4298.0,
"guinier_i0_error": null,
"pddf_rg": 4.13,
"pddf_rg_error": null,
"guinier_rg": 3.87,
"guinier_rg_error": null,
"pddf_dmax": 16.4,
"pddf_dmax_error": null,
"porod_volume": 239.5,
"porod_volume_error": null,
"estimated_volume": null,
"estimated_volume_error": null,
"guinier_point_first": null,
"guinier_point_last": null,
"pddf_point_first": null,
"pddf_point_last": null,
"i0_calibration_standard_data": null,
"intensities_log_log_plot": "SASDAC9_datloglog_img.png",
"symmetry": null,
"last_modified": "2019-12-06T13:07:15.624532+01:00",
"bragg_peak": []
}View the complete manifest.json source
{
"code": "SASDAC9",
"status": "success",
"started_at": "2026-08-11T16:11:05.858918+00:00",
"finished_at": "2026-08-11T16:11:15.436452+00:00",
"source_last_modified": "2019-12-06T13:07:15.624532+01:00",
"files": [
{
"status": "downloaded",
"url": "https://www.sasbdb.org/rest-api/entry/summary/SASDAC9/",
"path": "/data/saxsdb/sasbdb/entries/c9/sasdac9/source/summary.json",
"size": 7534,
"sha256": "c20914035931117e1317a79a69355d52d7af29ef578b2dd70e6a95560502d635"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/intensities_files/SASDAC9.dat",
"path": "/data/saxsdb/sasbdb/entries/c9/sasdac9/source/SASDAC9.dat",
"size": 22645,
"sha256": "9224492be8b6f9e7cc54550e67c4c60932794f6f77a011a98f587e8f7a085e91",
"role": "curve"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/p_of_R_files/SASDAC9.out",
"path": "/data/saxsdb/sasbdb/entries/c9/sasdac9/source/SASDAC9.out",
"size": 30729,
"sha256": "3b6739c39e39b600113011d421b4aa1a444987e7d6c602ace50c0abe529ac43a",
"role": "pddf"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDAC9.sascif",
"path": "/data/saxsdb/sasbdb/entries/c9/sasdac9/source/SASDAC9.sascif",
"size": 1393946,
"sha256": "5b18722b8c96a27c870d411f435237320d5beb929f242d0eefaf69751c0345a6",
"role": "sascif"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/zip_directories/SASDAC9.zip",
"path": "/data/saxsdb/sasbdb/entries/c9/sasdac9/source/SASDAC9.zip",
"size": 281360,
"sha256": "2d270eb976962005133e2ecdbdeec7a72be88633efab5e0b408f2c9822f6b527",
"role": "full_entry_zip",
"zip_member_count": 6,
"zip_validation": "central_directory_readable"
}
]
}
