The following content comes directly from the SASBDB entry. Missing values are shown as “—”; SAXSdb does not infer undeclared units.
Every source field is expanded here, including empty values, list members and fields already shown above.
View the complete summary.json source
{
"code": "SASDBZ3",
"status": "Published",
"type_of_curve": "Single concentration",
"angular_unit": "1/nm",
"project": {
"title": "Allosteric communication between DNA-binding and light-responsive domains of diatom class I aureochromes.",
"publication": {
"title": "Allosteric communication between DNA-binding and light-responsive domains of diatom class I aureochromes.",
"author_list": "Banerjee A, Herman E, Serif M, Maestre-Reyna M, Hepp S, Pokorny R, Kroth PG, Essen LO, Kottke T",
"journal": "Nucleic Acids Res",
"doi": "10.1093/nar/gkw420",
"pmid": "27179025",
"published_date": "2016 Jul 8"
},
"status": "released",
"submitted_date": "2016-02-14",
"released_date": "2016-09-19"
},
"pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDBZ3.out",
"intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDBZ3.dat",
"intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBZ3_dat_img.png",
"intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBZ3_kratky_img.png",
"pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDBZ3_pofr_img.png",
"intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBZ3_guinier_img.png",
"sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDBZ3.sascif",
"experiment": {
"instrument": {
"detector": {
"type": "Dectris",
"name": "Pilatus 1M",
"resolution": 172.0
},
"name": "ESRF",
"city": "Grenoble",
"country": "France",
"beamline_name": "BM29",
"beam_geometry": "",
"type_of_source": "X-ray synchrotron",
"point_source": null,
"line_collimation": null,
"sample_path_length": null,
"line_collimation_slitlength": null,
"line_collimation_integrationwidth": null,
"xray_energy": null,
"beam_profile_ah": null,
"beam_profile_al": null
},
"sample": {
"molecule": [
{
"long_name": "Aureobox dsDNA",
"short_name": null,
"sequence": "GAATTGTTGACGTGGAGTTGC\r\nGCAACTCCACGTCAACAATTC",
"organism": "synthetic construct",
"uniprot_code": null,
"uniprot_range_first": null,
"uniprot_range_last": null,
"oligomerization": "monomer",
"molecular_type": "DNA",
"uniprot_sequence": null,
"mw": 12.993,
"total_mw": 12.993,
"number_molecules": 1,
"complex_state": false,
"deuteration": null,
"molecule_source": "biological",
"molecule_description": null
},
{
"long_name": "Aureochrome 1a bZIP-LOV module",
"short_name": "PtAUREO1a bZIP-LOV",
"sequence": "MGSSHHHHHHSSGLVPRGSHMDRKMSEQQKVERRERNREHAKRSRIRKKFLLESLQQSVSLLKEENEKLKTSIRSHLGEEKADTLIDSANNNKTDVDGLLASSQGIANKVLDDPDFSFIKALQTAQQNFVVTDPSLPDNPIVYASQGFLNLTGYSLDQILGRNCRFLQGPETDPKAVERIRKAIEQGNDMSVCLLNYRVDGTTFWNQFFIAALRDAGGNVTNFVGVQCKVSDQYAATVTKQQEEEEEAAANDDED",
"organism": "Phaeodactylum tricornutum",
"uniprot_code": null,
"uniprot_range_first": 145,
"uniprot_range_last": 378,
"oligomerization": "dimer",
"molecular_type": "protein",
"uniprot_sequence": null,
"mw": 28.655,
"total_mw": 57.309,
"number_molecules": 2,
"complex_state": false,
"deuteration": null,
"molecule_source": "biological",
"molecule_description": null
}
],
"buffer": {
"name": "50 mM Tris 50 mM boric acid 1 mM EDTA",
"concentration_unit": "mM",
"comment": null,
"additive": "50 mM boric acid, 1 mM EDTA",
"concentration": 50.0,
"pka": null,
"ph": 8.0,
"deuteration": null
},
"purity_method": null,
"name": "Aureochrome 1a bZIP-LOV module: PtAUREO1a bZIP-LOV (Light oxygen voltage)/DNA complex (light state)",
"ext_coefficient": null,
"contrast": null,
"specific_vol": null,
"dry_vol": null,
"absorbption": null,
"deuteration": null,
"mixture": null
},
"contributor": [
{
"affiliation": [
{
"short_name": null,
"address": "Marburg, Germany",
"full_name": "Philipps-Universität Marburg",
"webpage": ""
}
],
"contributor_name": "Ankan",
"contributor_surname": "Banerjee",
"orcid": null
}
],
"concentration_method": null,
"concentration_unit": "mg/ml",
"date": "2014-11-06",
"storage_temperature": 4.0,
"cell_temperature": 4.0,
"exposure_time": 20.0,
"number_of_frames": 10,
"wavelength": 0.93,
"sample_detector_distance": 2.43,
"concentration_min": null,
"concentration_max": 1.25,
"sample_volume": null,
"flow_rate": null,
"s_min": 0.036,
"s_max": 4.975,
"total_exposure_time": null,
"seccolumn": null
},
"fits": [
{
"models": [
{
"model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDBZ3_fit1_model1_img.png",
"software": "DAMFILT",
"pdb_link": [],
"model_title": null,
"type_of_model": "dummy",
"software_version": "",
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDBZ3_fit1_model1.pdb",
"model_mw": null,
"bead_radius": 3.5,
"log": null,
"symmetry": "",
"comment": "Averaged and filtered/volume corrected model",
"user": 72
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDBZ3_fit1_fit_img.png",
"software": null,
"chi_square_value": 0.755,
"p_value": 0.1407,
"fit_residual_plot": "SASDBZ3_fit1_fitresiduals_img.png",
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDBZ3_fit1.fir",
"fit_log": null,
"software_version": null,
"description": null
}
],
"estimated_volume_method": null,
"pddf_software": "ATSAS GNOM",
"pddf_software_version": null,
"i0_calibration_standard": null,
"description": null,
"experiment_description": "X-ray synchrotron radiation scattering data from solution of PtAUREO1a bZIP-LOV module in complex with aureo box dsDNA in 0.5X TBE (50 mM Tris pH 8, 50 mM boric acid, 1 mM EDTA) buffer was collected on the BM29 camera on the storage ring ESRF (Grenoble, France) using a 2D Photon counting Pilatus 1M-W pixel detector (s = 4π sin θ/λ, where 2θ is the scattering angle). Ten successive 20 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted. Solution scattering data of complex in the light-state was performed at 1.25mg/mL concentration at 4 degrees centigrade. The modelling analysis was performed using the ATSAS package. The displayed model is an averaged and volume corrected dummy atom representation (DAMFILT). For further sequence information refer to the Joint Genome Institute (JGI) entry JGI-49116.",
"tags": [],
"intensity_unit": null,
"experimental_mw": 62.0,
"experimental_mw_error": null,
"guinier_i0_mw": null,
"guinier_i0_mw_error": null,
"porod_mw": null,
"porod_mw_error": null,
"pddf_i0": 63.87,
"pddf_i0_error": null,
"guinier_i0": 61.76,
"guinier_i0_error": null,
"pddf_rg": 4.876,
"pddf_rg_error": null,
"guinier_rg": 4.48,
"guinier_rg_error": null,
"pddf_dmax": 16.71,
"pddf_dmax_error": null,
"porod_volume": 97.05,
"porod_volume_error": null,
"estimated_volume": null,
"estimated_volume_error": null,
"guinier_point_first": 30,
"guinier_point_last": 48,
"pddf_point_first": null,
"pddf_point_last": null,
"i0_calibration_standard_data": null,
"intensities_log_log_plot": "SASDBZ3_datloglog_img.png",
"symmetry": null,
"last_modified": "2019-12-06T13:07:15.624532+01:00",
"bragg_peak": []
}View the complete manifest.json source
{
"code": "SASDBZ3",
"status": "success",
"started_at": "2026-08-11T14:11:29.181580+00:00",
"finished_at": "2026-08-11T14:11:39.105699+00:00",
"source_last_modified": "2019-12-06T13:07:15.624532+01:00",
"files": [
{
"status": "downloaded",
"url": "https://www.sasbdb.org/rest-api/entry/summary/SASDBZ3/",
"path": "/data/saxsdb/sasbdb/entries/z3/sasdbz3/source/summary.json",
"size": 8204,
"sha256": "3e6c60dbbe697387be871a35d3ba1d2bea98461120f2377cc58c7641d092218a"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/intensities_files/SASDBZ3.dat",
"path": "/data/saxsdb/sasbdb/entries/z3/sasdbz3/source/SASDBZ3.dat",
"size": 47623,
"sha256": "4ca5192a10d0e68e639ece6c45cc2e32e1ffead48d3741b1ae087f5d0268f83f",
"role": "curve"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/p_of_R_files/SASDBZ3.out",
"path": "/data/saxsdb/sasbdb/entries/z3/sasdbz3/source/SASDBZ3.out",
"size": 34152,
"sha256": "5faf11bd92cea59aa12bb3036326121bdfa5082debe35d3036b415f4277b8608",
"role": "pddf"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDBZ3.sascif",
"path": "/data/saxsdb/sasbdb/entries/z3/sasdbz3/source/SASDBZ3.sascif",
"size": 167138,
"sha256": "74e22f956f9a95ded15dd4b6e638a0f869e1349d5d6eb9540aa9b19e23e97024",
"role": "sascif"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/zip_directories/SASDBZ3.zip",
"path": "/data/saxsdb/sasbdb/entries/z3/sasdbz3/source/SASDBZ3.zip",
"size": 36103,
"sha256": "bebd28c7d87485f3b7eabf8328c7e2ba69fd9964c16a34fc48f8748083c89e0e",
"role": "full_entry_zip",
"zip_member_count": 4,
"zip_validation": "central_directory_readable"
}
]
}
