Truncated P5abc subdomain from tetrahymena ribozyme: Time-resolved 30ms

{
  "code": "SASDCA4",
  "status": "Published",
  "type_of_curve": "Single concentration",
  "angular_unit": "1/A",
  "project": {
    "title": "Revealing the distinct folding phases of an RNA three-helix junction.",
    "publication": {
      "title": "Revealing the distinct folding phases of an RNA three-helix junction.",
      "author_list": "Plumridge A, Katz AM, Calvey GD, Elber R, Kirmizialtin S, Pollack L",
      "journal": "Nucleic Acids Res",
      "doi": "10.1093/nar/gky363",
      "pmid": "29762712",
      "published_date": "2018 Aug 21"
    },
    "status": "released",
    "submitted_date": "2017-06-02",
    "released_date": "2018-05-20"
  },
  "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDCA4.out",
  "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDCA4.dat",
  "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCA4_dat_img.png",
  "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCA4_kratky_img.png",
  "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDCA4_pofr_img.png",
  "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCA4_guinier_img.png",
  "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDCA4.sascif",
  "experiment": {
    "instrument": {
      "detector": {
        "type": "CCD",
        "name": "Finger Lakes CCD",
        "resolution": 0.0
      },
      "name": "Cornell High Energy Synchrotron Source (CHESS)",
      "city": "Ithaca, NY",
      "country": "USA",
      "beamline_name": "G1",
      "beam_geometry": "",
      "type_of_source": "X-ray synchrotron",
      "point_source": null,
      "line_collimation": null,
      "sample_path_length": null,
      "line_collimation_slitlength": null,
      "line_collimation_integrationwidth": null,
      "xray_energy": null,
      "beam_profile_ah": null,
      "beam_profile_al": null
    },
    "sample": {
      "molecule": [
        {
          "long_name": "Truncated P5abc subdomain from tetrahymena ribozyme",
          "short_name": "tp5abc",
          "sequence": "GGCAGUACCAAGUCGCGAAAGCGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGCC",
          "organism": null,
          "uniprot_code": null,
          "uniprot_range_first": null,
          "uniprot_range_last": null,
          "oligomerization": "monomer",
          "molecular_type": "RNA",
          "uniprot_sequence": null,
          "mw": 18.223,
          "total_mw": 18.223,
          "number_molecules": 1,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": null
        }
      ],
      "buffer": {
        "name": "10mM KMOPS 20mM KCl 1mM MgCl2 20uM EDTA",
        "concentration_unit": null,
        "comment": "0ms time point",
        "additive": null,
        "concentration": null,
        "pka": null,
        "ph": 7.0,
        "deuteration": null
      },
      "purity_method": null,
      "name": "Truncated P5abc subdomain from tetrahymena ribozyme: Time-resolved 30ms",
      "ext_coefficient": null,
      "contrast": null,
      "specific_vol": null,
      "dry_vol": null,
      "absorbption": null,
      "deuteration": null,
      "mixture": null
    },
    "contributor": [
      {
        "affiliation": [
          {
            "short_name": null,
            "address": "Ithaca, NY, United States",
            "full_name": "Cornell University",
            "webpage": "https://www.cornell.edu/"
          }
        ],
        "contributor_name": "Alex",
        "contributor_surname": "Plumridge",
        "orcid": null
      }
    ],
    "concentration_method": null,
    "concentration_unit": null,
    "date": "2016-12-03",
    "storage_temperature": 4.0,
    "cell_temperature": 20.0,
    "exposure_time": 5.0,
    "number_of_frames": 50,
    "wavelength": 0.109,
    "sample_detector_distance": 1.72,
    "concentration_min": null,
    "concentration_max": 1.5,
    "sample_volume": null,
    "flow_rate": null,
    "s_min": 0.2,
    "s_max": 2.9,
    "total_exposure_time": null,
    "seccolumn": null
  },
  "fits": [],
  "estimated_volume_method": null,
  "pddf_software": "ATSAS GNOM",
  "pddf_software_version": null,
  "i0_calibration_standard": null,
  "description": null,
  "experiment_description": "Synchrotron SAXS data from solutions of Truncated P5abc subdomain from tetrahymena ribozyme: (Time-resolved 30ms) in 10mM KMOPS 20mM KCl 1mM MgCl2 20uM EDTA, pH 7 were collected on the G1 beam line at the Cornell High Energy Synchrotron Source (CHESS; Ithaca, NY, USA) using a CCD Finger Lakes CCD detector at a sample-detector distance of 1.7 m and at a wavelength of λ = 0.109 nm (I(s) vs s, where s = 4πsinθ/λ and 2θ is the scattering angle). One solute concentration of 1.50 mg/ml was measured at 20°C. 50 successive 5 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.",
  "tags": [],
  "intensity_unit": null,
  "experimental_mw": 27.8,
  "experimental_mw_error": null,
  "guinier_i0_mw": null,
  "guinier_i0_mw_error": null,
  "porod_mw": null,
  "porod_mw_error": null,
  "pddf_i0": 0.107,
  "pddf_i0_error": 0.051,
  "guinier_i0": 1.05,
  "guinier_i0_error": 0.014,
  "pddf_rg": 2.32,
  "pddf_rg_error": 0.01,
  "guinier_rg": 2.23,
  "guinier_rg_error": 0.04,
  "pddf_dmax": 7.0,
  "pddf_dmax_error": null,
  "porod_volume": null,
  "porod_volume_error": null,
  "estimated_volume": null,
  "estimated_volume_error": null,
  "guinier_point_first": 16,
  "guinier_point_last": 37,
  "pddf_point_first": null,
  "pddf_point_last": null,
  "i0_calibration_standard_data": null,
  "intensities_log_log_plot": "SASDCA4_datloglog_img.png",
  "symmetry": null,
  "last_modified": "2019-12-06T13:07:15.624532+01:00",
  "bragg_peak": []
}

{
  "code": "SASDCA4",
  "status": "success",
  "started_at": "2026-08-11T14:17:23.517014+00:00",
  "finished_at": "2026-08-11T14:17:30.489848+00:00",
  "source_last_modified": "2019-12-06T13:07:15.624532+01:00",
  "files": [
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/rest-api/entry/summary/SASDCA4/",
      "path": "/data/saxsdb/sasbdb/entries/a4/sasdca4/source/summary.json",
      "size": 5962,
      "sha256": "7af0b09ab34d8309f3f98033745c8b02721591f0806292e231d0711b9c9145ac"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/intensities_files/SASDCA4.dat",
      "path": "/data/saxsdb/sasbdb/entries/a4/sasdca4/source/SASDCA4.dat",
      "size": 7279,
      "sha256": "1bf82eeeddc3c9788086f7c182c47b3f02a02e9f9cd1ea7333d8aae923536d08",
      "role": "curve"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/p_of_R_files/SASDCA4.out",
      "path": "/data/saxsdb/sasbdb/entries/a4/sasdca4/source/SASDCA4.out",
      "size": 27578,
      "sha256": "ffd75140bb661cdc37c0bb268bf946b3eda3d91e0caa8f3cfb5d21b64e0498c3",
      "role": "pddf"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDCA4.sascif",
      "path": "/data/saxsdb/sasbdb/entries/a4/sasdca4/source/SASDCA4.sascif",
      "size": 39013,
      "sha256": "970a8c1d736bfe74a354d52d6b1a9f3b3ee484a7291c76a4207595ca903b71b8",
      "role": "sascif"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/zip_directories/SASDCA4.zip",
      "path": "/data/saxsdb/sasbdb/entries/a4/sasdca4/source/SASDCA4.zip",
      "size": 10110,
      "sha256": "090605c3f85344f1b80af4243013c6128602468557320e6d11ac575f815361ae",
      "role": "full_entry_zip",
      "zip_member_count": 2,
      "zip_validation": "central_directory_readable"
    }
  ]
}