SASDCC4

Truncated P5abc subdomain from tetrahymena ribozyme: Time-resolved 300ms

Data type: SASBDB experimental data Status: Published Curve type: Single concentration Last updated: 2019-12-06T13:07:15.624532+01:00

▼

1. Samples, Components and Experimental Conditions Sample & Experiment

Sample 1 · Truncated P5abc subdomain from tetrahymena ribozyme: Time-resolved 300ms

Concentration	— – 1.5	Buffer / pH	10mM KMOPS 20mM KCl 1mM MgCl2 20uM EDTA / 7.0
Experimental temperature	20.0	Facility / beamline	Cornell High Energy Synchrotron Source (CHESS) / G1
Wavelength	0.109 nm	Exposure	5.0 s × 50

Molecular Components

Component	Type / organism	UniProt and Construct	Oligomeric State	Molecular weight
Truncated P5abc subdomain from tetrahymena ribozyme View sequence GGCAGUACCAAGUCGCGAAAGCGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGCC	RNA—	——–—	monomerMolecule count 1	18.223 kDa

Experimental Curves

Curve	Points / columns	q range	Uncertainty quality	Negative-intensity points	Source file
1	276[3]	0.02–0.29 1/A	Has uncertainty columnMissing 0	15	sasbdb/entries/c4/sasdcc4/source/SASDCC4.dat

▼

2. Measurements Reported by SASBDB Reported Results

Metric	Method	Value	Uncertainty	Unit
dmax	P(r)	6.8	—	Å
i0	Guinier	0.94	0.012	—
i0	P(r)	0.95	0.04	—
mw	Experimental	28.6	—	kDa
rg	Guinier	2.18	0.03	Å
rg	P(r)	2.26	0.01	Å

These values are reported by SASBDB; SAXSdb did not recalculate them from the experimental curve.

▼

3. Source Fits and Models Source Fits & Models

This entry has no source fit record.

▶

4. Source File Index Source Files

Category	Path	Download status	Size
curve	sasbdb/entries/c4/sasdcc4/source/SASDCC4.dat	downloaded	7311
full_entry_zip	sasbdb/entries/c4/sasdcc4/source/SASDCC4.zip	downloaded	10096
pddf	sasbdb/entries/c4/sasdcc4/source/SASDCC4.out	downloaded	27437
sascif	sasbdb/entries/c4/sasdcc4/source/SASDCC4.sascif	downloaded	39015
summary	sasbdb/entries/c4/sasdcc4/source/summary.json	downloaded	5962

▶

5. Experiment Description and Publication Experiment & Publication

▼

6. Complete Source Record Complete Source Record

The following content comes directly from the SASBDB entry. Missing values are shown as “—”; SAXSdb does not infer undeclared units.

Open the original SASBDB entry

Buffer and Sample Properties

Buffer name	10mM KMOPS 20mM KCl 1mM MgCl2 20uM EDTA	Buffer concentration	—
pH	7.0	Additives	—
Buffer description	0ms time point
Purity measurement method	—	Extinction coefficient	—
Absorbance	—	Scattering contrast	—
Specific volume / dry volume	— / —	Mixture / deuteration	— / —

Acquisition Conditions and Instrument

Measurement date	2016-12-03	Storage / measurement temperature	4.0 / 20.0
Exposure time	5.0	Frames	50
Wavelength	0.109	Sample-to-detector distance	1.72
Source	X-ray synchrotron	Detector	Finger Lakes CCD
Facility / beamline	Cornell High Energy Synchrotron Source (CHESS) / G1 · Ithaca, NY, USA
q range	0.2 – 2.9	Sample volume / flow rate	— / —

Original SASBDB Plots

Downloadable Files

Category	File	Status	Size	Checksum	Download and View
curve	sasbdb/entries/c4/sasdcc4/source/SASDCC4.dat	downloaded	7311	bdf5973dfcef7630fac6fafcde1e43bc2e2afbf0a554ad1939d4f6286ae450dc	DownloadView source fileSource site
full_entry_zip	sasbdb/entries/c4/sasdcc4/source/SASDCC4.zip	downloaded	10096	c58f94fc0e320e597dc58196327712909c379918ec0a90e5753a9328c000ee9b	DownloadView source fileSource site
pddf	sasbdb/entries/c4/sasdcc4/source/SASDCC4.out	downloaded	27437	faa93292bdf7e32cd0e1d402e484ab1a495fd7f0598d9f2a2097f94fd61edb7b	DownloadView source fileSource site
sascif	sasbdb/entries/c4/sasdcc4/source/SASDCC4.sascif	downloaded	39015	9d32499ba0d8d50b00864734cbea92951942901b479571e8ffb4183ff8f32783	DownloadView source fileSource site
summary	sasbdb/entries/c4/sasdcc4/source/summary.json	downloaded	5962	f3f39bd659cb8aaba9ebd7a83bcfe6814def2bad6f729022aec2cf4bbecaf455	DownloadView source fileSource site

curve：source record

{
  "path": "/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/SASDCC4.dat",
  "role": "curve",
  "sha256": "bdf5973dfcef7630fac6fafcde1e43bc2e2afbf0a554ad1939d4f6286ae450dc",
  "size": 7311,
  "status": "downloaded",
  "url": "https://www.sasbdb.org/media/intensities_files/SASDCC4.dat"
}

full_entry_zip：source record and ZIP contents (2 items)

{
  "path": "/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/SASDCC4.zip",
  "role": "full_entry_zip",
  "sha256": "c58f94fc0e320e597dc58196327712909c379918ec0a90e5753a9328c000ee9b",
  "size": 10096,
  "status": "downloaded",
  "url": "https://www.sasbdb.org/media/zip_directories/SASDCC4.zip",
  "zip_member_count": 2,
  "zip_members": [
    {
      "crc32": "e1e7d008",
      "name": "SASDCC4/experimental_data/SASDCC4.dat",
      "size": 7311
    },
    {
      "crc32": "a1ec9550",
      "name": "SASDCC4/pddf/SASDCC4.out",
      "size": 27437
    }
  ],
  "zip_validation": "central_directory_readable"
}

pddf：source record

{
  "path": "/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/SASDCC4.out",
  "role": "pddf",
  "sha256": "faa93292bdf7e32cd0e1d402e484ab1a495fd7f0598d9f2a2097f94fd61edb7b",
  "size": 27437,
  "status": "downloaded",
  "url": "https://www.sasbdb.org/media/p_of_R_files/SASDCC4.out"
}

sascif：source record

{
  "path": "/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/SASDCC4.sascif",
  "role": "sascif",
  "sha256": "9d32499ba0d8d50b00864734cbea92951942901b479571e8ffb4183ff8f32783",
  "size": 39015,
  "status": "downloaded",
  "url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDCC4.sascif"
}

summary：source record

{
  "path": "/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/summary.json",
  "sha256": "f3f39bd659cb8aaba9ebd7a83bcfe6814def2bad6f729022aec2cf4bbecaf455",
  "size": 5962,
  "status": "downloaded",
  "url": "https://www.sasbdb.org/rest-api/entry/summary/SASDCC4/"
}

All source fields (unfiltered)

Every source field is expanded here, including empty values, list members and fields already shown above.

summary.json：134 field values

Field path	Raw value
code	SASDCC4
status	Published
type_of_curve	Single concentration
angular_unit	1/A
project.title	Revealing the distinct folding phases of an RNA three-helix junction.
project.publication.title	Revealing the distinct folding phases of an RNA three-helix junction.
project.publication.author_list	Plumridge A, Katz AM, Calvey GD, Elber R, Kirmizialtin S, Pollack L
project.publication.journal	Nucleic Acids Res
project.publication.doi	10.1093/nar/gky363
project.publication.pmid	29762712
project.publication.published_date	2018 Aug 21
project.status	released
project.submitted_date	2017-06-02
project.released_date	2018-05-20
pddf_data	https://www.sasbdb.org/media/p_of_R_files/SASDCC4.out
intensities_data	https://www.sasbdb.org/media/intensities_files/SASDCC4.dat
intensities_log_plot	https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCC4_dat_img.png
intensities_kratky_plot	https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCC4_kratky_img.png
pddf_plot	https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDCC4_pofr_img.png
intensities_guinier_plot	https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCC4_guinier_img.png
sascif_data	https://www.sasbdb.org/media/sascif/sascif_files/SASDCC4.sascif
experiment.instrument.detector.type	CCD
experiment.instrument.detector.name	Finger Lakes CCD
experiment.instrument.detector.resolution	0.0
experiment.instrument.name	Cornell High Energy Synchrotron Source (CHESS)
experiment.instrument.city	Ithaca, NY
experiment.instrument.country	USA
experiment.instrument.beamline_name	G1
experiment.instrument.beam_geometry
experiment.instrument.type_of_source	X-ray synchrotron
experiment.instrument.point_source	null
experiment.instrument.line_collimation	null
experiment.instrument.sample_path_length	null
experiment.instrument.line_collimation_slitlength	null
experiment.instrument.line_collimation_integrationwidth	null
experiment.instrument.xray_energy	null
experiment.instrument.beam_profile_ah	null
experiment.instrument.beam_profile_al	null
experiment.sample.molecule[0].long_name	Truncated P5abc subdomain from tetrahymena ribozyme
experiment.sample.molecule[0].short_name	tp5abc
experiment.sample.molecule[0].sequence	GGCAGUACCAAGUCGCGAAAGCGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGCC
experiment.sample.molecule[0].organism	null
experiment.sample.molecule[0].uniprot_code	null
experiment.sample.molecule[0].uniprot_range_first	null
experiment.sample.molecule[0].uniprot_range_last	null
experiment.sample.molecule[0].oligomerization	monomer
experiment.sample.molecule[0].molecular_type	RNA
experiment.sample.molecule[0].uniprot_sequence	null
experiment.sample.molecule[0].mw	18.223
experiment.sample.molecule[0].total_mw	18.223
experiment.sample.molecule[0].number_molecules	1
experiment.sample.molecule[0].complex_state	False
experiment.sample.molecule[0].deuteration	null
experiment.sample.molecule[0].molecule_source	biological
experiment.sample.molecule[0].molecule_description	null
experiment.sample.buffer.name	10mM KMOPS 20mM KCl 1mM MgCl2 20uM EDTA
experiment.sample.buffer.concentration_unit	null
experiment.sample.buffer.comment	0ms time point
experiment.sample.buffer.additive	null
experiment.sample.buffer.concentration	null
experiment.sample.buffer.pka	null
experiment.sample.buffer.ph	7.0
experiment.sample.buffer.deuteration	null
experiment.sample.purity_method	null
experiment.sample.name	Truncated P5abc subdomain from tetrahymena ribozyme: Time-resolved 300ms
experiment.sample.ext_coefficient	null
experiment.sample.contrast	null
experiment.sample.specific_vol	null
experiment.sample.dry_vol	null
experiment.sample.absorbption	null
experiment.sample.deuteration	null
experiment.sample.mixture	null
experiment.contributor[0].affiliation[0].short_name	null
experiment.contributor[0].affiliation[0].address	Ithaca, NY, United States
experiment.contributor[0].affiliation[0].full_name	Cornell University
experiment.contributor[0].affiliation[0].webpage	https://www.cornell.edu/
experiment.contributor[0].contributor_name	Alex
experiment.contributor[0].contributor_surname	Plumridge
experiment.contributor[0].orcid	null
experiment.concentration_method	null
experiment.concentration_unit	null
experiment.date	2016-12-03
experiment.storage_temperature	4.0
experiment.cell_temperature	20.0
experiment.exposure_time	5.0
experiment.number_of_frames	50
experiment.wavelength	0.109
experiment.sample_detector_distance	1.72
experiment.concentration_min	null
experiment.concentration_max	1.5
experiment.sample_volume	null
experiment.flow_rate	null
experiment.s_min	0.2
experiment.s_max	2.9
experiment.total_exposure_time	null
experiment.seccolumn	null
fits	[]
estimated_volume_method	null
pddf_software	ATSAS GNOM
pddf_software_version	null
i0_calibration_standard	null
description	null
experiment_description	Synchrotron SAXS data from solutions of Truncated P5abc subdomain from tetrahymena ribozyme: (Time-resolved 300ms) in 10mM KMOPS 20mM KCl 1mM MgCl2 20uM EDTA, pH 7 were collected on the G1 beam line at the Cornell High Energy Synchrotron Source (CHESS; Ithaca, NY, USA) using a CCD Finger Lakes CCD detector at a sample-detector distance of 1.7 m and at a wavelength of λ = 0.109 nm (I(s) vs s, where s = 4πsinθ/λ and 2θ is the scattering angle). One solute concentration of 1.50 mg/ml was measured at 20°C. 50 successive 5 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.
tags	[]
intensity_unit	null
experimental_mw	28.6
experimental_mw_error	null
guinier_i0_mw	null
guinier_i0_mw_error	null
porod_mw	null
porod_mw_error	null
pddf_i0	0.95
pddf_i0_error	0.04
guinier_i0	0.94
guinier_i0_error	0.012
pddf_rg	2.26
pddf_rg_error	0.01
guinier_rg	2.18
guinier_rg_error	0.03
pddf_dmax	6.8
pddf_dmax_error	null
porod_volume	null
porod_volume_error	null
estimated_volume	null
estimated_volume_error	null
guinier_point_first	19
guinier_point_last	42
pddf_point_first	null
pddf_point_last	null
i0_calibration_standard_data	null
intensities_log_log_plot	SASDCC4_datloglog_img.png
symmetry	null
last_modified	2019-12-06T13:07:15.624532+01:00
bragg_peak	[]

manifest.json：36 field values

Field path	Raw value
code	SASDCC4
status	success
started_at	2026-08-11T14:19:27.533049+00:00
finished_at	2026-08-11T14:19:34.477082+00:00
source_last_modified	2019-12-06T13:07:15.624532+01:00
files[0].status	downloaded
files[0].url	https://www.sasbdb.org/rest-api/entry/summary/SASDCC4/
files[0].path	/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/summary.json
files[0].size	5962
files[0].sha256	f3f39bd659cb8aaba9ebd7a83bcfe6814def2bad6f729022aec2cf4bbecaf455
files[1].status	downloaded
files[1].url	https://www.sasbdb.org/media/intensities_files/SASDCC4.dat
files[1].path	/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/SASDCC4.dat
files[1].size	7311
files[1].sha256	bdf5973dfcef7630fac6fafcde1e43bc2e2afbf0a554ad1939d4f6286ae450dc
files[1].role	curve
files[2].status	downloaded
files[2].url	https://www.sasbdb.org/media/p_of_R_files/SASDCC4.out
files[2].path	/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/SASDCC4.out
files[2].size	27437
files[2].sha256	faa93292bdf7e32cd0e1d402e484ab1a495fd7f0598d9f2a2097f94fd61edb7b
files[2].role	pddf
files[3].status	downloaded
files[3].url	https://www.sasbdb.org/media/sascif/sascif_files/SASDCC4.sascif
files[3].path	/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/SASDCC4.sascif
files[3].size	39015
files[3].sha256	9d32499ba0d8d50b00864734cbea92951942901b479571e8ffb4183ff8f32783
files[3].role	sascif
files[4].status	downloaded
files[4].url	https://www.sasbdb.org/media/zip_directories/SASDCC4.zip
files[4].path	/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/SASDCC4.zip
files[4].size	10096
files[4].sha256	c58f94fc0e320e597dc58196327712909c379918ec0a90e5753a9328c000ee9b
files[4].role	full_entry_zip
files[4].zip_member_count	2
files[4].zip_validation	central_directory_readable

View the complete summary.json source

{
  "code": "SASDCC4",
  "status": "Published",
  "type_of_curve": "Single concentration",
  "angular_unit": "1/A",
  "project": {
    "title": "Revealing the distinct folding phases of an RNA three-helix junction.",
    "publication": {
      "title": "Revealing the distinct folding phases of an RNA three-helix junction.",
      "author_list": "Plumridge A, Katz AM, Calvey GD, Elber R, Kirmizialtin S, Pollack L",
      "journal": "Nucleic Acids Res",
      "doi": "10.1093/nar/gky363",
      "pmid": "29762712",
      "published_date": "2018 Aug 21"
    },
    "status": "released",
    "submitted_date": "2017-06-02",
    "released_date": "2018-05-20"
  },
  "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDCC4.out",
  "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDCC4.dat",
  "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCC4_dat_img.png",
  "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCC4_kratky_img.png",
  "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDCC4_pofr_img.png",
  "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCC4_guinier_img.png",
  "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDCC4.sascif",
  "experiment": {
    "instrument": {
      "detector": {
        "type": "CCD",
        "name": "Finger Lakes CCD",
        "resolution": 0.0
      },
      "name": "Cornell High Energy Synchrotron Source (CHESS)",
      "city": "Ithaca, NY",
      "country": "USA",
      "beamline_name": "G1",
      "beam_geometry": "",
      "type_of_source": "X-ray synchrotron",
      "point_source": null,
      "line_collimation": null,
      "sample_path_length": null,
      "line_collimation_slitlength": null,
      "line_collimation_integrationwidth": null,
      "xray_energy": null,
      "beam_profile_ah": null,
      "beam_profile_al": null
    },
    "sample": {
      "molecule": [
        {
          "long_name": "Truncated P5abc subdomain from tetrahymena ribozyme",
          "short_name": "tp5abc",
          "sequence": "GGCAGUACCAAGUCGCGAAAGCGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGCC",
          "organism": null,
          "uniprot_code": null,
          "uniprot_range_first": null,
          "uniprot_range_last": null,
          "oligomerization": "monomer",
          "molecular_type": "RNA",
          "uniprot_sequence": null,
          "mw": 18.223,
          "total_mw": 18.223,
          "number_molecules": 1,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": null
        }
      ],
      "buffer": {
        "name": "10mM KMOPS 20mM KCl 1mM MgCl2 20uM EDTA",
        "concentration_unit": null,
        "comment": "0ms time point",
        "additive": null,
        "concentration": null,
        "pka": null,
        "ph": 7.0,
        "deuteration": null
      },
      "purity_method": null,
      "name": "Truncated P5abc subdomain from tetrahymena ribozyme: Time-resolved 300ms",
      "ext_coefficient": null,
      "contrast": null,
      "specific_vol": null,
      "dry_vol": null,
      "absorbption": null,
      "deuteration": null,
      "mixture": null
    },
    "contributor": [
      {
        "affiliation": [
          {
            "short_name": null,
            "address": "Ithaca, NY, United States",
            "full_name": "Cornell University",
            "webpage": "https://www.cornell.edu/"
          }
        ],
        "contributor_name": "Alex",
        "contributor_surname": "Plumridge",
        "orcid": null
      }
    ],
    "concentration_method": null,
    "concentration_unit": null,
    "date": "2016-12-03",
    "storage_temperature": 4.0,
    "cell_temperature": 20.0,
    "exposure_time": 5.0,
    "number_of_frames": 50,
    "wavelength": 0.109,
    "sample_detector_distance": 1.72,
    "concentration_min": null,
    "concentration_max": 1.5,
    "sample_volume": null,
    "flow_rate": null,
    "s_min": 0.2,
    "s_max": 2.9,
    "total_exposure_time": null,
    "seccolumn": null
  },
  "fits": [],
  "estimated_volume_method": null,
  "pddf_software": "ATSAS GNOM",
  "pddf_software_version": null,
  "i0_calibration_standard": null,
  "description": null,
  "experiment_description": "Synchrotron SAXS data from solutions of Truncated P5abc subdomain from tetrahymena ribozyme: (Time-resolved 300ms) in 10mM KMOPS 20mM KCl 1mM MgCl2 20uM EDTA, pH 7 were collected on the G1 beam line at the Cornell High Energy Synchrotron Source (CHESS; Ithaca, NY, USA) using a CCD Finger Lakes CCD detector at a sample-detector distance of 1.7 m and at a wavelength of λ = 0.109 nm (I(s) vs s, where s = 4πsinθ/λ and 2θ is the scattering angle). One solute concentration of 1.50 mg/ml was measured at 20°C. 50 successive 5 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.",
  "tags": [],
  "intensity_unit": null,
  "experimental_mw": 28.6,
  "experimental_mw_error": null,
  "guinier_i0_mw": null,
  "guinier_i0_mw_error": null,
  "porod_mw": null,
  "porod_mw_error": null,
  "pddf_i0": 0.95,
  "pddf_i0_error": 0.04,
  "guinier_i0": 0.94,
  "guinier_i0_error": 0.012,
  "pddf_rg": 2.26,
  "pddf_rg_error": 0.01,
  "guinier_rg": 2.18,
  "guinier_rg_error": 0.03,
  "pddf_dmax": 6.8,
  "pddf_dmax_error": null,
  "porod_volume": null,
  "porod_volume_error": null,
  "estimated_volume": null,
  "estimated_volume_error": null,
  "guinier_point_first": 19,
  "guinier_point_last": 42,
  "pddf_point_first": null,
  "pddf_point_last": null,
  "i0_calibration_standard_data": null,
  "intensities_log_log_plot": "SASDCC4_datloglog_img.png",
  "symmetry": null,
  "last_modified": "2019-12-06T13:07:15.624532+01:00",
  "bragg_peak": []
}

View the complete manifest.json source

{
  "code": "SASDCC4",
  "status": "success",
  "started_at": "2026-08-11T14:19:27.533049+00:00",
  "finished_at": "2026-08-11T14:19:34.477082+00:00",
  "source_last_modified": "2019-12-06T13:07:15.624532+01:00",
  "files": [
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/rest-api/entry/summary/SASDCC4/",
      "path": "/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/summary.json",
      "size": 5962,
      "sha256": "f3f39bd659cb8aaba9ebd7a83bcfe6814def2bad6f729022aec2cf4bbecaf455"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/intensities_files/SASDCC4.dat",
      "path": "/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/SASDCC4.dat",
      "size": 7311,
      "sha256": "bdf5973dfcef7630fac6fafcde1e43bc2e2afbf0a554ad1939d4f6286ae450dc",
      "role": "curve"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/p_of_R_files/SASDCC4.out",
      "path": "/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/SASDCC4.out",
      "size": 27437,
      "sha256": "faa93292bdf7e32cd0e1d402e484ab1a495fd7f0598d9f2a2097f94fd61edb7b",
      "role": "pddf"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDCC4.sascif",
      "path": "/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/SASDCC4.sascif",
      "size": 39015,
      "sha256": "9d32499ba0d8d50b00864734cbea92951942901b479571e8ffb4183ff8f32783",
      "role": "sascif"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/zip_directories/SASDCC4.zip",
      "path": "/data/saxsdb/sasbdb/entries/c4/sasdcc4/source/SASDCC4.zip",
      "size": 10096,
      "sha256": "c58f94fc0e320e597dc58196327712909c379918ec0a90e5753a9328c000ee9b",
      "role": "full_entry_zip",
      "zip_member_count": 2,
      "zip_validation": "central_directory_readable"
    }
  ]
}

Title	Revealing the distinct folding phases of an RNA three-helix junction.
Authors	Plumridge A, Katz AM, Calvey GD, Elber R, Kirmizialtin S, Pollack L
DOI / PMID	10.1093/nar/gky363 / 29762712