Human TERC 1-20 DNA G-quadruplex

{
  "code": "SASDCC8",
  "status": "Published",
  "type_of_curve": "Merged",
  "angular_unit": "1/A",
  "project": {
    "title": "Structure and hydrodynamics of a DNA G-quadruplex with a cytosine bulge.",
    "publication": {
      "title": "Structure and hydrodynamics of a DNA G-quadruplex with a cytosine bulge.",
      "author_list": "Meier M, Moya-Torres A, Krahn NJ, McDougall MD, Orriss GL, McRae EKS, Booy EP, McEleney K, Patel TR, McKenna SA, Stetefeld J",
      "journal": "Nucleic Acids Res",
      "doi": "10.1093/nar/gky307",
      "pmid": "29718405",
      "published_date": "2018 Jun 1"
    },
    "status": "released",
    "submitted_date": "2017-10-10",
    "released_date": "2018-05-01"
  },
  "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDCC8.out",
  "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDCC8.dat",
  "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCC8_dat_img.png",
  "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCC8_kratky_img.png",
  "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDCC8_pofr_img.png",
  "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCC8_guinier_img.png",
  "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDCC8.sascif",
  "experiment": {
    "instrument": {
      "detector": {
        "type": null,
        "name": "Pilatus 2M",
        "resolution": null
      },
      "name": "Diamond Light Source",
      "city": "Didcot",
      "country": "UK",
      "beamline_name": "B21",
      "beam_geometry": "1 x 5 mm",
      "type_of_source": "X-ray synchrotron",
      "point_source": null,
      "line_collimation": null,
      "sample_path_length": null,
      "line_collimation_slitlength": null,
      "line_collimation_integrationwidth": null,
      "xray_energy": null,
      "beam_profile_ah": null,
      "beam_profile_al": null
    },
    "sample": {
      "molecule": [
        {
          "long_name": "Human telomerase RNA template component, DNA counterpart, nucleotides 1-20",
          "short_name": "TERC DNA",
          "sequence": "GGGTTGCGGAGGGTGGGCCT",
          "organism": "Homo sapiens",
          "uniprot_code": null,
          "uniprot_range_first": 1,
          "uniprot_range_last": 20,
          "oligomerization": "dimer",
          "molecular_type": "DNA",
          "uniprot_sequence": null,
          "mw": 6.366,
          "total_mw": 12.732,
          "number_molecules": 2,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": null
        }
      ],
      "buffer": {
        "name": "20 mM HEPES, 100 mM KCl,",
        "concentration_unit": null,
        "comment": null,
        "additive": null,
        "concentration": null,
        "pka": null,
        "ph": 7.5,
        "deuteration": null
      },
      "purity_method": null,
      "name": "Human TERC 1-20 DNA G-quadruplex",
      "ext_coefficient": null,
      "contrast": null,
      "specific_vol": null,
      "dry_vol": null,
      "absorbption": null,
      "deuteration": null,
      "mixture": null
    },
    "contributor": [
      {
        "affiliation": [
          {
            "short_name": null,
            "address": "Winnipeg, Canada",
            "full_name": "University of Manitoba",
            "webpage": "http://umanitoba.ca/"
          }
        ],
        "contributor_name": "Markus",
        "contributor_surname": "Meier",
        "orcid": null
      }
    ],
    "concentration_method": null,
    "concentration_unit": null,
    "date": "2017-08-02",
    "storage_temperature": 4.0,
    "cell_temperature": 25.0,
    "exposure_time": 3.0,
    "number_of_frames": 9,
    "wavelength": 0.1,
    "sample_detector_distance": 4.014,
    "concentration_min": 2.0,
    "concentration_max": 2.0,
    "sample_volume": null,
    "flow_rate": null,
    "s_min": 0.059,
    "s_max": 3.898,
    "total_exposure_time": null,
    "seccolumn": null
  },
  "fits": [
    {
      "models": [
        {
          "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDCC8_fit1_model1_img.png",
          "software": "DAMMIN",
          "pdb_link": [],
          "model_title": null,
          "type_of_model": "dummy",
          "software_version": "r9678",
          "model_data": "https://www.sasbdb.org/media/pdb_file/SASDCC8_fit1_model1.pdb",
          "model_mw": null,
          "bead_radius": 1.25,
          "log": "https://www.sasbdb.org/media/log_files/004_3_MM_p1_shape_compact-hollow_dammin_expert.log",
          "symmetry": "P1",
          "comment": "Fixed core calculated from 20 dammif models using compact-hollow shape assumption",
          "user": 210
        }
      ],
      "fit_unit": "1/A",
      "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDCC8_fit1_fit_img.png",
      "software": "DAMMIN",
      "chi_square_value": 1.346,
      "p_value": 0.003043,
      "fit_residual_plot": "SASDCC8_fit1_fitresiduals_img.png",
      "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDCC8_fit1.fir",
      "fit_log": "https://www.sasbdb.org/media/fitting_files/log_files/004_3_MM_p1_shape_compact-hollow_dammin_expert.log",
      "software_version": "r9678",
      "description": null
    },
    {
      "models": [
        {
          "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDCC8_fit2_model1_img.png",
          "software": "DAMMIN",
          "pdb_link": [],
          "model_title": null,
          "type_of_model": "dummy",
          "software_version": "r9678",
          "model_data": "https://www.sasbdb.org/media/pdb_file/SASDCC8_fit2_model1.pdb",
          "model_mw": null,
          "bead_radius": 1.25,
          "log": "https://www.sasbdb.org/media/log_files/004_3_MM_p1_shape_compact_dammin_expert_UzSfNku.log",
          "symmetry": "P1",
          "comment": "Fixed core calculated from 20 dammif models using compact shape assumption.",
          "user": 210
        }
      ],
      "fit_unit": "1/A",
      "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDCC8_fit2_fit_img.png",
      "software": "DAMMIN",
      "chi_square_value": 1.346,
      "p_value": 0.003043,
      "fit_residual_plot": "SASDCC8_fit2_fitresiduals_img.png",
      "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDCC8_fit2.fir",
      "fit_log": "https://www.sasbdb.org/media/fitting_files/log_files/004_3_MM_p1_shape_compact_dammin_expert.log",
      "software_version": "r9678",
      "description": null
    },
    {
      "models": [
        {
          "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDCC8_fit3_model1_img.png",
          "software": "DAMMIN",
          "pdb_link": [],
          "model_title": null,
          "type_of_model": "dummy",
          "software_version": "r9678",
          "model_data": "https://www.sasbdb.org/media/pdb_file/SASDCC8_fit3_model1.pdb",
          "model_mw": null,
          "bead_radius": 1.25,
          "log": "https://www.sasbdb.org/media/log_files/004_3_MM_p1_shape_unknown_dammin_expert.log",
          "symmetry": "P1",
          "comment": "Fixed core calculated from 20 dammif models using unknown shape assumption.",
          "user": 210
        }
      ],
      "fit_unit": "1/A",
      "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDCC8_fit3_fit_img.png",
      "software": "DAMMIN",
      "chi_square_value": 1.346,
      "p_value": 0.003043,
      "fit_residual_plot": "SASDCC8_fit3_fitresiduals_img.png",
      "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDCC8_fit3.fir",
      "fit_log": "https://www.sasbdb.org/media/fitting_files/log_files/004_3_MM_p1_shape_unknown_dammin_expert.log",
      "software_version": "r9678",
      "description": null
    }
  ],
  "estimated_volume_method": null,
  "pddf_software": "ATSAS GNOM",
  "pddf_software_version": "r9678",
  "i0_calibration_standard": null,
  "description": null,
  "experiment_description": "Synchrotron SEC-SAXS data collection was performed at the B21 beamline of the Diamond Light Source (UK) using a Pilatus 2M detector at a sample-detector distance of 4.0 m and at a wavelength of λ = 0.1 nm (I(s) vs s, where s = 4πsinθ/λ and 2θ is the scattering angle). 50 µl purified hTERC 1-20 DNA G-quadruplex at a concentration of  5.58 mg/ml was injected into a 4.6 ml Shodex KW402.5-4F size exclusion column at a flow rate of 0.16 ml/min that was connected to the SAXS flow cell (25°C). The column diluted the sample 3-fold to approximately 2 mg/ml. Each frame was exposed for 3 seconds. 9 frames of the sample peak region were integrated, buffer subtracted and merged using the ScÅtter software package (http://www.bioisis.net/scatter). Guinier Rg, I(0) and their standard uncertainties were determined with GNOM/DATRG from ATSAS suite 2.8.2 (https://www.embl-hamburg.de/biosaxs/software.html). The Porod volume was calculated with DATPOROD from the ATSAS suite. The molecular weight derived from I(0) was calculated with SAXSMoW2 (http://saxs.ifsc.usp.br) and corrected for the appropriate mass density of the G-quadruplex DNA (1.85 g/cm³).",
  "tags": [],
  "intensity_unit": "arbitrary",
  "experimental_mw": 14.14,
  "experimental_mw_error": null,
  "guinier_i0_mw": 14.14,
  "guinier_i0_mw_error": null,
  "porod_mw": null,
  "porod_mw_error": null,
  "pddf_i0": 0.0547,
  "pddf_i0_error": 3e-05,
  "guinier_i0": 0.05469,
  "guinier_i0_error": 3e-05,
  "pddf_rg": 1.419,
  "pddf_rg_error": 0.002,
  "guinier_rg": 1.42,
  "guinier_rg_error": 0.001,
  "pddf_dmax": 4.62,
  "pddf_dmax_error": null,
  "porod_volume": 15.1,
  "porod_volume_error": null,
  "estimated_volume": null,
  "estimated_volume_error": null,
  "guinier_point_first": 36,
  "guinier_point_last": 450,
  "pddf_point_first": null,
  "pddf_point_last": null,
  "i0_calibration_standard_data": null,
  "intensities_log_log_plot": "SASDCC8_datloglog_img.png",
  "symmetry": null,
  "last_modified": "2019-12-06T13:07:15.624532+01:00",
  "bragg_peak": []
}

{
  "code": "SASDCC8",
  "status": "success",
  "started_at": "2026-08-11T15:50:11.831300+00:00",
  "finished_at": "2026-08-11T15:50:21.566393+00:00",
  "source_last_modified": "2019-12-06T13:07:15.624532+01:00",
  "files": [
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/rest-api/entry/summary/SASDCC8/",
      "path": "/data/saxsdb/sasbdb/entries/c8/sasdcc8/source/summary.json",
      "size": 10207,
      "sha256": "f58922d6a870155d88c4ea84f4de40b554cc6c0a0c54381a8391eee691417aba"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/intensities_files/SASDCC8.dat",
      "path": "/data/saxsdb/sasbdb/entries/c8/sasdcc8/source/SASDCC8.dat",
      "size": 78818,
      "sha256": "f0e82d8b97c33c57324afda6c18053a9202cbd83375c77361dbbf3619d11a7dd",
      "role": "curve"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/p_of_R_files/SASDCC8.out",
      "path": "/data/saxsdb/sasbdb/entries/c8/sasdcc8/source/SASDCC8.out",
      "size": 136667,
      "sha256": "37595fcf2dbe8b2bcb10a13fe09ad1055a5762d50daba177a220264f7f14a353",
      "role": "pddf"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDCC8.sascif",
      "path": "/data/saxsdb/sasbdb/entries/c8/sasdcc8/source/SASDCC8.sascif",
      "size": 965821,
      "sha256": "1b67baf51e9cfc3fe54186fa192cd1836f77cbb71fcf9b38d78786926eb3ee88",
      "role": "sascif"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/zip_directories/SASDCC8.zip",
      "path": "/data/saxsdb/sasbdb/entries/c8/sasdcc8/source/SASDCC8.zip",
      "size": 181558,
      "sha256": "4456828e7624430d4d2bb99d27b2ded40bfefc792d77f76978e267dcec9d3e4a",
      "role": "full_entry_zip",
      "zip_member_count": 8,
      "zip_validation": "central_directory_readable"
    }
  ]
}