Light encoded DNA biosensor: e13AB DNA

{
  "code": "SASDCH5",
  "status": "Published",
  "type_of_curve": "Merged",
  "angular_unit": "1/nm",
  "project": {
    "title": "Optical and Structural Characterization of a Chronic Myeloid Leukemia DNA Biosensor.",
    "publication": {
      "title": "Optical and Structural Characterization of a Chronic Myeloid Leukemia DNA Biosensor.",
      "author_list": "Cordeiro M, Otrelo-Cardoso AR, Svergun DI, Konarev PV, Lima JC, Santos-Silva T, Baptista PV",
      "journal": "ACS Chem Biol",
      "doi": "10.1021/acschembio.8b00029",
      "pmid": "29562136",
      "published_date": "2018 May 18"
    },
    "status": "released",
    "submitted_date": "2017-06-23",
    "released_date": "2018-04-03"
  },
  "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDCH5.out",
  "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDCH5.dat",
  "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCH5_dat_img.png",
  "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCH5_kratky_img.png",
  "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDCH5_pofr_img.png",
  "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCH5_guinier_img.png",
  "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDCH5.sascif",
  "experiment": {
    "instrument": {
      "detector": {
        "type": "Dectris",
        "name": "Pilatus 1M",
        "resolution": 172.0
      },
      "name": "ESRF",
      "city": "Grenoble",
      "country": "France",
      "beamline_name": "BM29",
      "beam_geometry": "",
      "type_of_source": "X-ray synchrotron",
      "point_source": null,
      "line_collimation": null,
      "sample_path_length": null,
      "line_collimation_slitlength": null,
      "line_collimation_integrationwidth": null,
      "xray_energy": null,
      "beam_profile_ah": null,
      "beam_profile_al": null
    },
    "sample": {
      "molecule": [
        {
          "long_name": "e13AB",
          "short_name": null,
          "sequence": "ccacgccaaacgctgaagggcttcttccttatttttggcgtggccacgccaaacgctgaagggcttcttccttatttttggcgtggccacgccaaacgctgaagggcttcttccttatttttggcgtggccacgccaaacgctgaagggcttcttccttatttttggcgtggccacgccaaacgctgaagggcttcttccttatttttggcgtggccacgccaaacgctgaagggcttcttccttatttttggcgtgg",
          "organism": null,
          "uniprot_code": null,
          "uniprot_range_first": null,
          "uniprot_range_last": null,
          "oligomerization": "monomer",
          "molecular_type": "DNA",
          "uniprot_sequence": null,
          "mw": 79.448,
          "total_mw": 79.448,
          "number_molecules": 1,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": null
        }
      ],
      "buffer": {
        "name": "154 mM NaCl",
        "concentration_unit": null,
        "comment": null,
        "additive": null,
        "concentration": null,
        "pka": null,
        "ph": 8.3,
        "deuteration": null
      },
      "purity_method": null,
      "name": "Light encoded DNA biosensor: e13AB DNA",
      "ext_coefficient": null,
      "contrast": null,
      "specific_vol": null,
      "dry_vol": null,
      "absorbption": null,
      "deuteration": null,
      "mixture": null
    },
    "contributor": [
      {
        "affiliation": [
          {
            "short_name": "EMBL-Hamburg",
            "address": "Notkestraße 85, Geb. 25A, 22607 Hamburg, Deutschland, Germany",
            "full_name": "European Molecular Biology Laboratory (EMBL) - Hamburg outstation",
            "webpage": "http://www.embl-hamburg.de/index.php"
          }
        ],
        "contributor_name": "Petr",
        "contributor_surname": "Konarev",
        "orcid": null
      }
    ],
    "concentration_method": null,
    "concentration_unit": null,
    "date": "2013-11-22",
    "storage_temperature": 5.0,
    "cell_temperature": 5.0,
    "exposure_time": 0.05,
    "number_of_frames": 20,
    "wavelength": 0.1,
    "sample_detector_distance": 3.0,
    "concentration_min": 0.25,
    "concentration_max": 2.0,
    "sample_volume": null,
    "flow_rate": null,
    "s_min": 0.244,
    "s_max": 4.494,
    "total_exposure_time": null,
    "seccolumn": null
  },
  "fits": [
    {
      "models": [
        {
          "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDCH5_fit1_model1_img.png",
          "software": "DAMFILT",
          "pdb_link": [],
          "model_title": null,
          "type_of_model": "dummy",
          "software_version": "",
          "model_data": "https://www.sasbdb.org/media/pdb_file/SASDCH5_fit1_model1.pdb",
          "model_mw": null,
          "bead_radius": 4.25,
          "log": null,
          "symmetry": "",
          "comment": "",
          "user": 88
        }
      ],
      "fit_unit": "1/A",
      "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDCH5_fit1_fit_img.png",
      "software": "DAMMIF",
      "chi_square_value": 12.569,
      "p_value": 0.0,
      "fit_residual_plot": "SASDCH5_fit1_fitresiduals_img.png",
      "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDCH5_fit1.fir",
      "fit_log": null,
      "software_version": "",
      "description": null
    }
  ],
  "estimated_volume_method": null,
  "pddf_software": "ATSAS GNOM",
  "pddf_software_version": "GNOM45",
  "i0_calibration_standard": null,
  "description": null,
  "experiment_description": "Synchrotron SAXS data from solutions of Light encoded DNA biosensor: e13AB DNA in 154 mM NaCl, pH 8.3 were collected at the BM29 beam line at the ESRF (Grenoble, France) using a Pilatus 1M detector at a sample-detector distance of 3 m and at a wavelength of λ = 0.1 nm (I(s) vs s, where s = 4πsinθ/λ and 2θ is the scattering angle). Solute concentrations ranging between 0.3 and 2 mg/ml were measured at 5°C. 20 successive 0.050 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted and the different curves were scaled for protein concentration. The low angle data collected at lower concentration were merged with the highest concentration high angle data to yield the final composite scattering curve. The model depicts the averaged spatial representation of the DNA (DAMFILT occupancy and volume-corrected bead model).",
  "tags": [],
  "intensity_unit": null,
  "experimental_mw": 79.0,
  "experimental_mw_error": null,
  "guinier_i0_mw": 78.0,
  "guinier_i0_mw_error": 5.0,
  "porod_mw": 75.0,
  "porod_mw_error": null,
  "pddf_i0": 167.0,
  "pddf_i0_error": 10.0,
  "guinier_i0": 156.117,
  "guinier_i0_error": 1.48,
  "pddf_rg": 5.4,
  "pddf_rg_error": 0.4,
  "guinier_rg": 4.73,
  "guinier_rg_error": 0.04,
  "pddf_dmax": 20.0,
  "pddf_dmax_error": 1.0,
  "porod_volume": 103.0,
  "porod_volume_error": null,
  "estimated_volume": null,
  "estimated_volume_error": null,
  "guinier_point_first": 1,
  "guinier_point_last": 8,
  "pddf_point_first": null,
  "pddf_point_last": null,
  "i0_calibration_standard_data": null,
  "intensities_log_log_plot": "SASDCH5_datloglog_img.png",
  "symmetry": null,
  "last_modified": "2019-12-06T13:07:15.624532+01:00",
  "bragg_peak": []
}

{
  "code": "SASDCH5",
  "status": "success",
  "started_at": "2026-08-11T14:48:16.220456+00:00",
  "finished_at": "2026-08-11T14:48:24.123071+00:00",
  "source_last_modified": "2019-12-06T13:07:15.624532+01:00",
  "files": [
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/rest-api/entry/summary/SASDCH5/",
      "path": "/data/saxsdb/sasbdb/entries/h5/sasdch5/source/summary.json",
      "size": 7402,
      "sha256": "88f12a75671f0d1cc29c13d7a9f6656d5f3475bbfcfbe23641b3602229b71fba"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/intensities_files/SASDCH5.dat",
      "path": "/data/saxsdb/sasbdb/entries/h5/sasdch5/source/SASDCH5.dat",
      "size": 45855,
      "sha256": "3b33c711a7c91c9d9a2144c5ea5408d18811225c9120315e69d7eff9f37b426d",
      "role": "curve"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/p_of_R_files/SASDCH5.out",
      "path": "/data/saxsdb/sasbdb/entries/h5/sasdch5/source/SASDCH5.out",
      "size": 43122,
      "sha256": "5593c7278fce4ed1595ea661d21dfdbbfd75598a26d10c8f3e1174358ad81b93",
      "role": "pddf"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDCH5.sascif",
      "path": "/data/saxsdb/sasbdb/entries/h5/sasdch5/source/SASDCH5.sascif",
      "size": 138439,
      "sha256": "42b8837e06ff81e5719cc3e32fe8032ec063e0a83c6114d3a09fa0ee2ea934c8",
      "role": "sascif"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/zip_directories/SASDCH5.zip",
      "path": "/data/saxsdb/sasbdb/entries/h5/sasdch5/source/SASDCH5.zip",
      "size": 32424,
      "sha256": "39a39684c1d3a79725028d43cb64a9095e72483632d71d4de77096a4020bc877",
      "role": "full_entry_zip",
      "zip_member_count": 4,
      "zip_validation": "central_directory_readable"
    }
  ]
}