The following content comes directly from the SASBDB entry. Missing values are shown as “—”; SAXSdb does not infer undeclared units.
Every source field is expanded here, including empty values, list members and fields already shown above.
View the complete summary.json source
{
"code": "SASDGE3",
"status": "Published",
"type_of_curve": "Single concentration",
"angular_unit": "1/A",
"project": {
"title": "Nucleoid remodeling during environmental adaptation is regulated by HU-dependent DNA bundling.",
"publication": {
"title": "Nucleoid remodeling during environmental adaptation is regulated by HU-dependent DNA bundling.",
"author_list": "Remesh SG, Verma SC, Chen JH, Ekman AA, Larabell CA, Adhya S, Hammel M",
"journal": "Nat Commun",
"doi": "10.1038/s41467-020-16724-5",
"pmid": "32518228",
"published_date": "2020 Jun 9"
},
"status": "released",
"submitted_date": "2019-04-26",
"released_date": "2020-04-21"
},
"pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDGE3.out",
"intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDGE3.dat",
"intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDGE3_dat_img.png",
"intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDGE3_kratky_img.png",
"pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDGE3_pofr_img.png",
"intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDGE3_guinier_img.png",
"sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDGE3.sascif",
"experiment": {
"instrument": {
"detector": {
"type": null,
"name": "Pilatus3 X 2M",
"resolution": 172.0
},
"name": "Advanced Light Source (ALS)",
"city": "Berkeley, CA",
"country": "USA",
"beamline_name": "12.3.1 (SIBYLS)",
"beam_geometry": "",
"type_of_source": "X-ray synchrotron",
"point_source": null,
"line_collimation": null,
"sample_path_length": null,
"line_collimation_slitlength": null,
"line_collimation_integrationwidth": null,
"xray_energy": null,
"beam_profile_ah": null,
"beam_profile_al": null
},
"sample": {
"molecule": [
{
"long_name": "80bp_DNA Forward",
"short_name": null,
"sequence": "AATGAGGTAACAACGAAAGCAGATGATAGCTGCTTATCAATTTGTTGCAAACAAGTAGCCGCGCCCAATGAGGTAACAAT",
"organism": "Escherichia coli",
"uniprot_code": null,
"uniprot_range_first": null,
"uniprot_range_last": null,
"oligomerization": "monomer",
"molecular_type": "DNA",
"uniprot_sequence": null,
"mw": 24.849,
"total_mw": 24.849,
"number_molecules": 1,
"complex_state": false,
"deuteration": null,
"molecule_source": "biological",
"molecule_description": null
},
{
"long_name": "80bp_DNA Reverse",
"short_name": null,
"sequence": "TTACTCCATTGTTGCTTTCGTCTACTATCGACGAATAGTTAAACAACGTTTGTTCATCGGCGCGGGTTACTCCATTGTTA",
"organism": "Escherichia coli",
"uniprot_code": null,
"uniprot_range_first": null,
"uniprot_range_last": null,
"oligomerization": "monomer",
"molecular_type": "DNA",
"uniprot_sequence": null,
"mw": 24.612,
"total_mw": 24.612,
"number_molecules": 1,
"complex_state": false,
"deuteration": null,
"molecule_source": "biological",
"molecule_description": null
},
{
"long_name": "DNA-binding protein HU-alpha, E34K",
"short_name": null,
"sequence": "MNKTQLIDVI AEKAELSKTQ AKAALESTLA AITKSLKEGD AVQLVGFGTF KVNHRAERTG\r\nRNPQTGKEIK IAAANVPAFV SGKALKDAVK",
"organism": "Escherichia coli",
"uniprot_code": null,
"uniprot_range_first": null,
"uniprot_range_last": null,
"oligomerization": "other",
"molecular_type": "protein",
"uniprot_sequence": null,
"mw": 9.534,
"total_mw": 100.0,
"number_molecules": 16,
"complex_state": false,
"deuteration": null,
"molecule_source": "biological",
"molecule_description": null
}
],
"buffer": {
"name": "10 mM Bis-Tris, 50 mM NaCl",
"concentration_unit": null,
"comment": null,
"additive": null,
"concentration": null,
"pka": null,
"ph": 7.5,
"deuteration": null
},
"purity_method": null,
"name": "DNA-binding protein HU-alpha, E34K mutant bound to 80 bp DNA (pH 7.5)",
"ext_coefficient": null,
"contrast": null,
"specific_vol": null,
"dry_vol": null,
"absorbption": null,
"deuteration": null,
"mixture": null
},
"contributor": [
{
"affiliation": [
{
"short_name": "UCSF",
"address": "San Francisco, CA, USA",
"full_name": "University of California, San Francisco (UCSF)",
"webpage": "https://www.ucsf.edu/"
}
],
"contributor_name": "Soumya",
"contributor_surname": "G Remesh",
"orcid": ""
}
],
"concentration_method": null,
"concentration_unit": null,
"date": "2018-11-02",
"storage_temperature": 10.0,
"cell_temperature": 10.0,
"exposure_time": 3.0,
"number_of_frames": 300,
"wavelength": 0.103,
"sample_detector_distance": 1.5,
"concentration_min": null,
"concentration_max": null,
"sample_volume": null,
"flow_rate": null,
"s_min": 0.081,
"s_max": 3.921,
"total_exposure_time": null,
"seccolumn": null
},
"fits": [],
"estimated_volume_method": null,
"pddf_software": "ATSAS GNOM",
"pddf_software_version": "5.0",
"i0_calibration_standard": null,
"description": null,
"experiment_description": "Synchrotron SAXS data from solutions of DNA-binding protein HU-alpha (E34K mutant) bound to 80 bp DNA in 10 mM Bis-Tris, 50 mM NaCl, pH 7.5 were collected on the 12.3.1 (SIBYLS) beam line at the Advanced Light Source (ALS) storage ring (Berkeley, CA, USA) using a Pilatus3 X 2M detector at a sample-detector distance of 1.5 m and at a wavelength of λ = 0.103 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). 300 successive 3 second frames were collected at 10°C. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.",
"tags": [],
"intensity_unit": "arbitrary",
"experimental_mw": 157.0,
"experimental_mw_error": null,
"guinier_i0_mw": null,
"guinier_i0_mw_error": null,
"porod_mw": null,
"porod_mw_error": null,
"pddf_i0": 384.9,
"pddf_i0_error": null,
"guinier_i0": 391.06,
"guinier_i0_error": 4.4,
"pddf_rg": 7.53,
"pddf_rg_error": null,
"guinier_rg": 7.132,
"guinier_rg_error": 7.57,
"pddf_dmax": 27.5,
"pddf_dmax_error": null,
"porod_volume": 309.0,
"porod_volume_error": null,
"estimated_volume": null,
"estimated_volume_error": null,
"guinier_point_first": 3,
"guinier_point_last": 19,
"pddf_point_first": null,
"pddf_point_last": null,
"i0_calibration_standard_data": null,
"intensities_log_log_plot": "SASDGE3_datloglog_img.png",
"symmetry": null,
"last_modified": "2020-06-22T11:00:53.614275+02:00",
"bragg_peak": []
}View the complete manifest.json source
{
"code": "SASDGE3",
"status": "success",
"started_at": "2026-08-11T16:53:01.936309+00:00",
"finished_at": "2026-08-11T16:53:09.930693+00:00",
"source_last_modified": "2020-06-22T11:00:53.614275+02:00",
"files": [
{
"status": "downloaded",
"url": "https://www.sasbdb.org/rest-api/entry/summary/SASDGE3/",
"path": "/data/saxsdb/sasbdb/entries/e3/sasdge3/source/summary.json",
"size": 7381,
"sha256": "fecd0e08f9d55419a099e45a5e1d67ab2198c69fdd814c2d6ef5825899411e5b"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/intensities_files/SASDGE3.dat",
"path": "/data/saxsdb/sasbdb/entries/e3/sasdge3/source/SASDGE3.dat",
"size": 19070,
"sha256": "6bacf77503149d92ea634b9cfdaf5b99d675ec320d0aa4d516cd520be82663eb",
"role": "curve"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/p_of_R_files/SASDGE3.out",
"path": "/data/saxsdb/sasbdb/entries/e3/sasdge3/source/SASDGE3.out",
"size": 39472,
"sha256": "8e06366d08226a76c74b7fd56e29a0ffbd23123806de5ce1c8500e8053aafbde",
"role": "pddf"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDGE3.sascif",
"path": "/data/saxsdb/sasbdb/entries/e3/sasdge3/source/SASDGE3.sascif",
"size": 66270,
"sha256": "24cabd9f4646e71780b22420061ed39f3c818cb979ead45ab25a2da3fc8a1623",
"role": "sascif"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/zip_directories/SASDGE3.zip",
"path": "/data/saxsdb/sasbdb/entries/e3/sasdge3/source/SASDGE3.zip",
"size": 19243,
"sha256": "72b8af9c30c52125d645daf4e727ea8f2cea5c081254556c181ea1f48ac6b3ed",
"role": "full_entry_zip",
"zip_member_count": 2,
"zip_validation": "central_directory_readable"
}
]
}
