The following content comes directly from the SASBDB entry. Missing values are shown as “—”; SAXSdb does not infer undeclared units.
Every source field is expanded here, including empty values, list members and fields already shown above.
View the complete summary.json source
{
"code": "SASDGF3",
"status": "Published",
"type_of_curve": "Extrapolated to infinite dilution",
"angular_unit": "1/A",
"project": {
"title": "Long non-coding subgenomic flavivirus RNAs have extended 3D structures and are flexible in solution.",
"publication": {
"title": "Long non-coding subgenomic flavivirus RNAs have extended 3D structures and are flexible in solution.",
"author_list": "Zhang Y, Zhang Y, Liu ZY, Cheng ML, Ma J, Wang Y, Qin CF, Fang X",
"journal": "EMBO Rep",
"doi": "10.15252/embr.201847016",
"pmid": "31502753",
"published_date": "2019 Nov 5"
},
"status": "released",
"submitted_date": "2019-08-10",
"released_date": "2019-09-05"
},
"pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDGF3.out",
"intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDGF3.dat",
"intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDGF3_dat_img.png",
"intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDGF3_kratky_img.png",
"pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDGF3_pofr_img.png",
"intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDGF3_guinier_img.png",
"sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDGF3.sascif",
"experiment": {
"instrument": {
"detector": {
"type": null,
"name": "Pilatus 2M",
"resolution": null
},
"name": "Advanced Photon Source (APS), Argonne National Laboratory",
"city": "Lemont, IL",
"country": "USA",
"beamline_name": "12-ID-B SAXS/WAXS",
"beam_geometry": null,
"type_of_source": "X-ray synchrotron",
"point_source": null,
"line_collimation": null,
"sample_path_length": null,
"line_collimation_slitlength": null,
"line_collimation_integrationwidth": null,
"xray_energy": null,
"beam_profile_ah": null,
"beam_profile_al": null
},
"sample": {
"molecule": [
{
"long_name": "Xrn1 resistance RNA2 from Zika virus",
"short_name": "ZIKV-xrRNA2",
"sequence": "AGUCAGGCCGAGAACGCCAUGGCACGGAAGAAGCCAUGCUGCCUGUGAGCCCCUCAGAGGACACUGAG",
"organism": "Zika virus",
"uniprot_code": null,
"uniprot_range_first": null,
"uniprot_range_last": null,
"oligomerization": "monomer",
"molecular_type": "RNA",
"uniprot_sequence": null,
"mw": 22.091,
"total_mw": 22.091,
"number_molecules": 1,
"complex_state": false,
"deuteration": null,
"molecule_source": "biological",
"molecule_description": null
}
],
"buffer": {
"name": "20mM Tris-HCl, 100mM NaCl, 5mM MgCl2",
"concentration_unit": null,
"comment": null,
"additive": null,
"concentration": null,
"pka": null,
"ph": 7.5,
"deuteration": null
},
"purity_method": null,
"name": "Xrn1 resistance RNA1 from Zika virus",
"ext_coefficient": null,
"contrast": null,
"specific_vol": null,
"dry_vol": null,
"absorbption": null,
"deuteration": null,
"mixture": null
},
"contributor": [
{
"affiliation": [
{
"short_name": null,
"address": null,
"full_name": "Tsinghua University",
"webpage": null
}
],
"contributor_name": "Zhang",
"contributor_surname": "Yikan",
"orcid": ""
}
],
"concentration_method": null,
"concentration_unit": null,
"date": "2016-12-09",
"storage_temperature": 4.0,
"cell_temperature": 25.0,
"exposure_time": 0.5,
"number_of_frames": 30,
"wavelength": 0.08857,
"sample_detector_distance": 2.0,
"concentration_min": 0.25,
"concentration_max": 3.0,
"sample_volume": null,
"flow_rate": null,
"s_min": 0.0,
"s_max": 3.0,
"total_exposure_time": null,
"seccolumn": null
},
"fits": [
{
"models": [
{
"model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDGF3_fit1_model1_img.png",
"software": "Other",
"pdb_link": [
{
"pdb_code": "5tpy",
"ext_code": "5TPY",
"ext_type": "pdb",
"difference_with_model": "derived"
}
],
"model_title": null,
"type_of_model": "atomic",
"software_version": null,
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDGF3_fit1_model1.pdb",
"model_mw": 23.91,
"bead_radius": null,
"log": null,
"symmetry": null,
"comment": null,
"user": 479
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/zk-d1-pk00_fixed_fit_img.png",
"software": "CRYSOL",
"chi_square_value": 0.754,
"p_value": 0.0,
"fit_residual_plot": "zk-d1-pk00_fitresiduals_img.png",
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDGF3_fit1.fit",
"fit_log": null,
"software_version": "2.8.3",
"description": ""
},
{
"models": [
{
"model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDGF3_fit2_model1_img.png",
"software": "DAMFILT",
"pdb_link": [],
"model_title": null,
"type_of_model": "dummy",
"software_version": "2.8.3",
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDGF3_fit2_model1.pdb",
"model_mw": null,
"bead_radius": 2.25,
"log": null,
"symmetry": null,
"comment": null,
"user": 479
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/zk_30_7-1_fixed_fit_img.png",
"software": "DAMMIN",
"chi_square_value": 0.495,
"p_value": 0.0,
"fit_residual_plot": "zk_30_7-1_fitresiduals_img.png",
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDGF3_fit2.fir",
"fit_log": null,
"software_version": "2.8.3",
"description": ""
}
],
"estimated_volume_method": null,
"pddf_software": "ATSAS GNOM",
"pddf_software_version": null,
"i0_calibration_standard": null,
"description": "The subtracted SAXS data series used to generate the final extrapolated to zero-concentration profile displayed in this entry are provided in the full entry zip archive. The ab initio dummy atom model represents the averaged spatial disposition of the RNA in solution (DAMFILT model), derived from several aligned individual models (corresponding fit).",
"experiment_description": null,
"tags": [],
"intensity_unit": "arbitrary",
"experimental_mw": 22.14,
"experimental_mw_error": null,
"guinier_i0_mw": null,
"guinier_i0_mw_error": null,
"porod_mw": 21.15,
"porod_mw_error": null,
"pddf_i0": 0.08694,
"pddf_i0_error": 0.00031,
"guinier_i0": 0.08672,
"guinier_i0_error": 0.00043,
"pddf_rg": 2.5,
"pddf_rg_error": 0.01,
"guinier_rg": 2.43,
"guinier_rg_error": 0.02,
"pddf_dmax": 8.5,
"pddf_dmax_error": 0.2,
"porod_volume": 33.84,
"porod_volume_error": null,
"estimated_volume": null,
"estimated_volume_error": null,
"guinier_point_first": 2,
"guinier_point_last": 28,
"pddf_point_first": null,
"pddf_point_last": null,
"i0_calibration_standard_data": null,
"intensities_log_log_plot": "SASDGF3_datloglog_img.png",
"symmetry": null,
"last_modified": "2023-03-02T16:54:16.648202+01:00",
"bragg_peak": []
}View the complete manifest.json source
{
"code": "SASDGF3",
"status": "success",
"started_at": "2026-08-11T13:59:03.148530+00:00",
"finished_at": "2026-08-11T13:59:13.739115+00:00",
"source_last_modified": "2023-03-02T16:54:16.648202+01:00",
"files": [
{
"status": "downloaded",
"url": "https://www.sasbdb.org/rest-api/entry/summary/SASDGF3/",
"path": "/data/saxsdb/sasbdb/entries/f3/sasdgf3/source/summary.json",
"size": 7850,
"sha256": "6d8c14be73cc0f28e814d54a48c7b56b03b8a8fae4f6e79948e5105997263d48"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/intensities_files/SASDGF3.dat",
"path": "/data/saxsdb/sasbdb/entries/f3/sasdgf3/source/SASDGF3.dat",
"size": 3930,
"sha256": "b546f9191dd14a5d3bd60d7cb2b19189b9cb772f9a7c2682cc5daf37fa8ce110",
"role": "curve"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/p_of_R_files/SASDGF3.out",
"path": "/data/saxsdb/sasbdb/entries/f3/sasdgf3/source/SASDGF3.out",
"size": 16584,
"sha256": "daf32df8dba402da5382d9ba9e6e7ac08546d5e9fd6c5cf7be427f13ea224b0f",
"role": "pddf"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDGF3.sascif",
"path": "/data/saxsdb/sasbdb/entries/f3/sasdgf3/source/SASDGF3.sascif",
"size": 269488,
"sha256": "bf1e4ee7e5696db2810b38d1a6a8823dfc914a6b46ad1b8fcedcfed260505ceb",
"role": "sascif"
},
{
"status": "downloaded",
"url": "https://www.sasbdb.org/media/zip_directories/SASDGF3.zip",
"path": "/data/saxsdb/sasbdb/entries/f3/sasdgf3/source/SASDGF3.zip",
"size": 62024,
"sha256": "2036c0a24cbf54923063ff5e2df9a255a16efd7e0b17b89d244e8afe51d81fcc",
"role": "full_entry_zip",
"zip_member_count": 8,
"zip_validation": "central_directory_readable"
}
]
}
