查看完整 summary.json 原文
{
"code": "SASDUX8",
"status": "Published",
"type_of_curve": "Single concentration",
"angular_unit": "1/A",
"project": {
"title": "Selective deuteration of an RNA:RNA complex for structural analysis using small-angle scattering.",
"publication": {
"title": "Selective deuteration of an RNA:RNA complex for structural analysis using small-angle scattering.",
"author_list": "Munsayac A, Leite WC, Hopkins JB, Hall I, O'Neill HM, Keane SC",
"journal": "Structure",
"doi": "10.1016/j.str.2025.01.017",
"pmid": "39933513",
"published_date": "2025 Feb 6"
},
"status": "released",
"submitted_date": "2024-05-16",
"released_date": "2025-01-15"
},
"pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDUX8.out",
"intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDUX8.dat",
"intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDUX8_dat_img.png",
"intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDUX8_kratky_img.png",
"pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDUX8_pofr_img.png",
"intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDUX8_guinier_img.png",
"sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDUX8.sascif",
"experiment": {
"instrument": {
"detector": {
"type": "Main 1 m x 1 m, Wide angle 1 m x 0.8 m",
"name": "2–dimensional linear position-sensitive detector",
"resolution": 256.0
},
"name": "High Flux Isotope Reactor",
"city": "Oak Ridge",
"country": "United States",
"beamline_name": "CG-3",
"beam_geometry": null,
"type_of_source": "neutron source",
"point_source": null,
"line_collimation": null,
"sample_path_length": null,
"line_collimation_slitlength": null,
"line_collimation_integrationwidth": null,
"xray_energy": null,
"beam_profile_ah": null,
"beam_profile_al": null
},
"sample": {
"molecule": [
{
"long_name": "HIV-1 dimerization initiation site with a CCCCCC apical loop",
"short_name": "DIS-C",
"sequence": "GGGCUUGCUGAACCCCCCACGGCAAGACC",
"organism": null,
"uniprot_code": null,
"uniprot_range_first": null,
"uniprot_range_last": null,
"oligomerization": "monomer",
"molecular_type": "RNA",
"uniprot_sequence": "",
"mw": 9.336,
"total_mw": 9.336,
"number_molecules": 1,
"complex_state": false,
"deuteration": null,
"molecule_source": "biological",
"molecule_description": ""
},
{
"long_name": "HIV-1 DIS with a GGGGGG apical loop, UCU bulge, and 16 bp helical extension",
"short_name": "DIS-Gk",
"sequence": "GGGUCGCGCUGGCAGAUCUGGGCUUGCUGAAGGGGGGACGGCAAGACCUCUGCCAGCGCGACCC",
"organism": null,
"uniprot_code": null,
"uniprot_range_first": null,
"uniprot_range_last": null,
"oligomerization": "monomer",
"molecular_type": "RNA",
"uniprot_sequence": "",
"mw": 20.839,
"total_mw": 20.839,
"number_molecules": 1,
"complex_state": false,
"deuteration": null,
"molecule_source": "biological",
"molecule_description": ""
}
],
"buffer": {
"name": "50 mM potassium phosphate buffer, 1 mM MgCl2, 50 mM NaCl",
"concentration_unit": null,
"comment": null,
"additive": null,
"concentration": null,
"pka": null,
"ph": 7.5,
"deuteration": null
},
"purity_method": null,
"name": "HIV-1 ²H(42%)-DIS-C:¹H-DIS-Gk RNA heterocomplex (DIS-C contrast matched in 90% v/v D₂O - SANS data)",
"ext_coefficient": null,
"contrast": null,
"specific_vol": null,
"dry_vol": null,
"absorbption": null,
"deuteration": null,
"mixture": null
},
"contributor": [
{
"affiliation": [
{
"short_name": null,
"address": null,
"full_name": "University of Michigan",
"webpage": null
}
],
"contributor_name": "Aldrex",
"contributor_surname": "Munsayac",
"orcid": "https://orcid.org/0000-0001-7268-020X"
}
],
"concentration_method": null,
"concentration_unit": null,
"date": "2023-09-15",
"storage_temperature": 4.0,
"cell_temperature": 20.0,
"exposure_time": 68400.0,
"number_of_frames": 1,
"wavelength": 0.6,
"sample_detector_distance": 7.0,
"concentration_min": null,
"concentration_max": 10.0,
"sample_volume": 250.0,
"flow_rate": 0.6,
"s_min": 0.07,
"s_max": 9.254,
"total_exposure_time": null,
"seccolumn": null
},
"fits": [
{
"models": [
{
"model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDUX8_fit1_model1_img.png",
"software": "RNAMasonry",
"pdb_link": [],
"model_title": null,
"type_of_model": "atomic",
"software_version": null,
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDUX8_fit1_model1.pdb",
"model_mw": 20.06,
"bead_radius": null,
"log": null,
"symmetry": null,
"comment": null,
"user": 788
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDUX8_fit1_fixed_fit_img.png",
"software": "CRYSON",
"chi_square_value": 1.51,
"p_value": 0.6214,
"fit_residual_plot": "SASDUX8_fit1_fitresiduals_img.png",
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDUX8_fit1.fit",
"fit_log": null,
"software_version": null,
"description": ""
}
],
"estimated_volume_method": null,
"pddf_software": "ATSAS GNOM",
"pddf_software_version": "5.0",
"i0_calibration_standard": null,
"description": null,
"experiment_description": "SANS data from solutions of the HIV-1 ²H(42%)-DIS-C:¹H-DIS-Gk RNA heterocomplex in 50 mM potassium phosphate buffer, 1 mM MgCl2, 50 mM NaCl, 90% v/v D2O, pH 7.5 were collected on the CG-3 bio-SANS instrument at the High Flux Isotope Reactor, Oak Ridge National Laboratory, (TN, USA) using a 2–dimensional linear position-sensitive detector detector at a sample-detector distance of 7 m and at a wavelength of λ = 0.6 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). One solute concentration of 10.00 mg/ml was measured at 20°C over a period of 68400 seconds. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.",
"tags": [],
"intensity_unit": "1/cm",
"experimental_mw": 17.8,
"experimental_mw_error": null,
"guinier_i0_mw": null,
"guinier_i0_mw_error": null,
"porod_mw": null,
"porod_mw_error": null,
"pddf_i0": 0.003017,
"pddf_i0_error": 0.0001725,
"guinier_i0": 0.00346767,
"guinier_i0_error": 0.00024168,
"pddf_rg": 2.638,
"pddf_rg_error": 0.134,
"guinier_rg": 2.899,
"guinier_rg_error": 0.296,
"pddf_dmax": 9.7,
"pddf_dmax_error": null,
"porod_volume": null,
"porod_volume_error": null,
"estimated_volume": null,
"estimated_volume_error": null,
"guinier_point_first": 4,
"guinier_point_last": 55,
"pddf_point_first": null,
"pddf_point_last": null,
"i0_calibration_standard_data": null,
"intensities_log_log_plot": "SASDUX8_datloglog_img.png",
"symmetry": null,
"last_modified": "2025-02-12T14:50:27.004792+01:00",
"bragg_peak": []
}
