The following content comes directly from the SASBDB entry. Missing values are shown as “—”; SAXSdb does not infer undeclared units.
Every source field is expanded here, including empty values, list members and fields already shown above.
View the complete summary.json source
{
"code": "SASDV25",
"status": "Published",
"type_of_curve": "SEC-SAS",
"angular_unit": "1/nm",
"project": {
"title": "A conserved viral RNA fold enables nuclease resistance across kingdoms of life.",
"publication": {
"title": "A conserved viral RNA fold enables nuclease resistance across kingdoms of life.",
"author_list": "Gezelle JG, Korn SM, McDonald JT, Gong Z, Erickson A, Huang CH, Yang F, Cronin M, Kuo YW, Wimberly BT, Steckelberg AL",
"journal": "Nucleic Acids Res",
"doi": "10.1093/nar/gkaf840",
"pmid": "40884403",
"published_date": "2025 Aug 27"
},
"status": "released",
"submitted_date": "2024-07-12",
"released_date": "2025-07-12"
},
"pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDV25.out",
"intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDV25.dat",
"intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDV25_dat_img.png",
"intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDV25_kratky_img.png",
"pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDV25_pofr_img.png",
"intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDV25_guinier_img.png",
"sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDV25.sascif",
"experiment": {
"instrument": {
"detector": {
"type": null,
"name": "Pilatus3 S 1M",
"resolution": 172.0
},
"name": "National Synchrotron Light Source II (NSLS-II)",
"city": "Upton, NY",
"country": "USA",
"beamline_name": "16-ID (LiX)",
"beam_geometry": null,
"type_of_source": "X-ray synchrotron",
"point_source": true,
"line_collimation": null,
"sample_path_length": null,
"line_collimation_slitlength": null,
"line_collimation_integrationwidth": null,
"xray_energy": null,
"beam_profile_ah": null,
"beam_profile_al": null
},
"sample": {
"molecule": [
{
"long_name": "ST9 PKmutant (59 nt RNA)",
"short_name": null,
"sequence": "AAGUACCCUCCAAGCCCUACAGGUUGGAAGAGGGGGCUAUCAGUCCUGAUGGCAGACUC",
"organism": null,
"uniprot_code": null,
"uniprot_range_first": null,
"uniprot_range_last": null,
"oligomerization": "monomer",
"molecular_type": "RNA",
"uniprot_sequence": "",
"mw": 19.075,
"total_mw": 19.075,
"number_molecules": 1,
"complex_state": false,
"deuteration": null,
"molecule_source": "biological",
"molecule_description": ""
}
],
"buffer": {
"name": "50 mM Tris pH 7.5, 100 mM NaCl, 1 mM DTT, 0.0002% w/v NaN3",
"concentration_unit": null,
"comment": "0 mM MgCl2 buffer",
"additive": null,
"concentration": null,
"pka": null,
"ph": null,
"deuteration": null
},
"purity_method": null,
"name": "ST9a RNA, PKmutant (59 nucleotides in 0 mM MgCl2; monomer)",
"ext_coefficient": null,
"contrast": null,
"specific_vol": null,
"dry_vol": null,
"absorbption": null,
"deuteration": null,
"mixture": null
},
"contributor": [
{
"affiliation": [
{
"short_name": null,
"address": null,
"full_name": "Columbia University Irving Medical Center",
"webpage": null
}
],
"contributor_name": "Sophie",
"contributor_surname": "Korn",
"orcid": "https://orcid.org/0000-0003-3798-3277"
}
],
"concentration_method": null,
"concentration_unit": null,
"date": "2024-01-30",
"storage_temperature": 20.0,
"cell_temperature": 20.0,
"exposure_time": 2.0,
"number_of_frames": 1200,
"wavelength": 0.082,
"sample_detector_distance": 3.561,
"concentration_min": null,
"concentration_max": 3.0,
"sample_volume": 95.0,
"flow_rate": 0.75,
"s_min": 0.06,
"s_max": 10.0,
"total_exposure_time": null,
"seccolumn": 1
},
"fits": [
{
"models": [
{
"model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDV25_fit1_model1_img.png",
"software": "PyMOL",
"pdb_link": [],
"model_title": null,
"type_of_model": "atomic",
"software_version": null,
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDV25_fit1_model1.pdb",
"model_mw": 17.12,
"bead_radius": null,
"log": null,
"symmetry": null,
"comment": null,
"user": 1092
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDV25_fit1_fixed_fit_img.png",
"software": "CRYSOL",
"chi_square_value": 125.7195,
"p_value": 0.0,
"fit_residual_plot": "SASDV25_fit1_fitresiduals_img.png",
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDV25_fit1.fit",
"fit_log": null,
"software_version": null,
"description": ""
},
{
"models": [
{
"model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDV25_fit2_model1_img.png",
"software": "RNAMasonry",
"pdb_link": [],
"model_title": null,
"type_of_model": "atomic",
"software_version": null,
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDV25_fit2_model1.pdb",
"model_mw": 18.36,
"bead_radius": null,
"log": null,
"symmetry": null,
"comment": null,
"user": 1092
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDV25_fit2_fixed_fit_img.png",
"software": "CRYSOL",
"chi_square_value": 0.958,
"p_value": 0.1724,
"fit_residual_plot": "SASDV25_fit2_fitresiduals_img.png",
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDV25_fit2.fit",
"fit_log": null,
"software_version": null,
"description": ""
}
],
"estimated_volume_method": null,
"pddf_software": "ATSAS GNOM",
"pddf_software_version": null,
"i0_calibration_standard": null,
"description": null,
"experiment_description": "Synchrotron SAXS data from solutions of ST9 RNA, PKmutant (59 nucleotides) in 50 mM Tris pH 7.5, 100 mM NaCl, 1 mM DTT, 0.0002% w/v NaN3 were collected on the 16-ID (LiX) beam line at the National Synchrotron Light Source II (NSLS-II; Upton, NY, USA) using a Pilatus3 S 1M detector at a sample-detector distance of 3.6 m and at a wavelength of λ = 0.082 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). In-line size-exclusion chromatography (SEC) SAS was employed. The SEC parameters were as follows: A 95.00 μl sample at 3 mg/ml was injected at a 0.75 ml/min flow rate onto a GE Superdex 200 Increase 10/300 column at 20°C. 1200 successive 2 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.",
"tags": [],
"intensity_unit": "arbitrary",
"experimental_mw": 23.05,
"experimental_mw_error": null,
"guinier_i0_mw": null,
"guinier_i0_mw_error": null,
"porod_mw": null,
"porod_mw_error": null,
"pddf_i0": 5.033,
"pddf_i0_error": null,
"guinier_i0": 4.98777,
"guinier_i0_error": null,
"pddf_rg": 2.605,
"pddf_rg_error": null,
"guinier_rg": 2.53,
"guinier_rg_error": 0.02,
"pddf_dmax": 8.83,
"pddf_dmax_error": null,
"porod_volume": 29.0,
"porod_volume_error": null,
"estimated_volume": null,
"estimated_volume_error": null,
"guinier_point_first": 9,
"guinier_point_last": 45,
"pddf_point_first": null,
"pddf_point_last": null,
"i0_calibration_standard_data": null,
"intensities_log_log_plot": "SASDV25_datloglog_img.png",
"symmetry": null,
"last_modified": "2025-09-01T15:31:27.545060+02:00",
"bragg_peak": []
}
