ST9a RNA, PKmutant (59 nucleotides in 10 mM MgCl2; dimer)

{
  "code": "SASDVZ4",
  "status": "Published",
  "type_of_curve": "SEC-SAS",
  "angular_unit": "1/nm",
  "project": {
    "title": "A conserved viral RNA fold enables nuclease resistance across kingdoms of life.",
    "publication": {
      "title": "A conserved viral RNA fold enables nuclease resistance across kingdoms of life.",
      "author_list": "Gezelle JG, Korn SM, McDonald JT, Gong Z, Erickson A, Huang CH, Yang F, Cronin M, Kuo YW, Wimberly BT, Steckelberg AL",
      "journal": "Nucleic Acids Res",
      "doi": "10.1093/nar/gkaf840",
      "pmid": "40884403",
      "published_date": "2025 Aug 27"
    },
    "status": "released",
    "submitted_date": "2024-07-12",
    "released_date": "2025-07-12"
  },
  "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDVZ4.out",
  "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDVZ4.dat",
  "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDVZ4_dat_img.png",
  "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDVZ4_kratky_img.png",
  "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDVZ4_pofr_img.png",
  "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDVZ4_guinier_img.png",
  "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDVZ4.sascif",
  "experiment": {
    "instrument": {
      "detector": {
        "type": null,
        "name": "Pilatus3 S 1M",
        "resolution": 172.0
      },
      "name": "National Synchrotron Light Source II (NSLS-II)",
      "city": "Upton, NY",
      "country": "USA",
      "beamline_name": "16-ID (LiX)",
      "beam_geometry": null,
      "type_of_source": "X-ray synchrotron",
      "point_source": true,
      "line_collimation": null,
      "sample_path_length": null,
      "line_collimation_slitlength": null,
      "line_collimation_integrationwidth": null,
      "xray_energy": null,
      "beam_profile_ah": null,
      "beam_profile_al": null
    },
    "sample": {
      "molecule": [
        {
          "long_name": "ST9 PKmutant (59 nt RNA)",
          "short_name": null,
          "sequence": "AAGUACCCUCCAAGCCCUACAGGUUGGAAGAGGGGGCUAUCAGUCCUGAUGGCAGACUC",
          "organism": null,
          "uniprot_code": null,
          "uniprot_range_first": null,
          "uniprot_range_last": null,
          "oligomerization": "dimer",
          "molecular_type": "RNA",
          "uniprot_sequence": "",
          "mw": 19.075,
          "total_mw": 38.15,
          "number_molecules": 2,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": ""
        }
      ],
      "buffer": {
        "name": "50 mM Tris pH 7.5, 100 mM NaCl, 1 mM DTT, 10 mM MgCl2, 0.0002% w/v NaN3",
        "concentration_unit": null,
        "comment": "10 mM MgCl2 buffer",
        "additive": null,
        "concentration": null,
        "pka": null,
        "ph": null,
        "deuteration": null
      },
      "purity_method": null,
      "name": "ST9a RNA, PKmutant (59 nucleotides in 10 mM MgCl2; dimer)",
      "ext_coefficient": null,
      "contrast": null,
      "specific_vol": null,
      "dry_vol": null,
      "absorbption": null,
      "deuteration": null,
      "mixture": null
    },
    "contributor": [
      {
        "affiliation": [
          {
            "short_name": null,
            "address": null,
            "full_name": "Columbia University Irving Medical Center",
            "webpage": null
          }
        ],
        "contributor_name": "Sophie",
        "contributor_surname": "Korn",
        "orcid": "https://orcid.org/0000-0003-3798-3277"
      }
    ],
    "concentration_method": null,
    "concentration_unit": null,
    "date": "2024-01-30",
    "storage_temperature": 20.0,
    "cell_temperature": 20.0,
    "exposure_time": 2.0,
    "number_of_frames": 1200,
    "wavelength": 0.082,
    "sample_detector_distance": 3.561,
    "concentration_min": null,
    "concentration_max": 3.0,
    "sample_volume": 95.0,
    "flow_rate": 0.75,
    "s_min": 0.06,
    "s_max": 10.0,
    "total_exposure_time": null,
    "seccolumn": 1
  },
  "fits": [],
  "estimated_volume_method": null,
  "pddf_software": "ATSAS GNOM",
  "pddf_software_version": null,
  "i0_calibration_standard": null,
  "description": null,
  "experiment_description": "Synchrotron SAXS data from solutions of ST9 RNA, PKmutant (59 nucleotides) in 50 mM Tris pH 7.5, 100 mM NaCl, 1 mM DTT, 10 mM MgCl2, 0.0002% w/v NaN3 were collected on the 16-ID (LiX) beam line at the National Synchrotron Light Source II (NSLS-II; Upton, NY, USA) using a Pilatus3 S 1M detector at a sample-detector distance of 3.6 m and at a wavelength of λ = 0.082 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). In-line size-exclusion chromatography (SEC) SAS was employed. The SEC parameters were as follows: A 95.00 μl sample at 3 mg/ml was injected at a 0.75 ml/min flow rate onto a GE Superdex 200 Increase 10/300 column at 20°C. 1200 successive 2 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.",
  "tags": [],
  "intensity_unit": "arbitrary",
  "experimental_mw": 43.7,
  "experimental_mw_error": null,
  "guinier_i0_mw": null,
  "guinier_i0_mw_error": null,
  "porod_mw": null,
  "porod_mw_error": null,
  "pddf_i0": 10.4,
  "pddf_i0_error": null,
  "guinier_i0": 10.2851,
  "guinier_i0_error": null,
  "pddf_rg": 3.648,
  "pddf_rg_error": null,
  "guinier_rg": 3.52,
  "guinier_rg_error": 0.024,
  "pddf_dmax": 12.81,
  "pddf_dmax_error": null,
  "porod_volume": 61.9,
  "porod_volume_error": null,
  "estimated_volume": null,
  "estimated_volume_error": null,
  "guinier_point_first": 8,
  "guinier_point_last": 31,
  "pddf_point_first": null,
  "pddf_point_last": null,
  "i0_calibration_standard_data": null,
  "intensities_log_log_plot": "SASDVZ4_datloglog_img.png",
  "symmetry": null,
  "last_modified": "2025-09-01T15:31:28.121164+02:00",
  "bragg_peak": []
}

{
  "code": "SASDVZ4",
  "status": "success",
  "started_at": "2026-08-11T16:43:10.885085+00:00",
  "finished_at": "2026-08-11T16:43:17.387204+00:00",
  "source_last_modified": "2025-09-01T15:31:28.121164+02:00",
  "files": [
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/rest-api/entry/summary/SASDVZ4/",
      "path": "/data/saxsdb/sasbdb/entries/z4/sasdvz4/source/summary.json",
      "size": 6193,
      "sha256": "71b2691b255549fdb0b27e2ee9d68b8ea7c199ecf0596ded6507aec2cb02f054"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/intensities_files/SASDVZ4.dat",
      "path": "/data/saxsdb/sasbdb/entries/z4/sasdvz4/source/SASDVZ4.dat",
      "size": 11557,
      "sha256": "9c1785b6f45ac7508cef37d5bbdba7d7de235a44a93fdf305055f56950546b32",
      "role": "curve"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/p_of_R_files/SASDVZ4.out",
      "path": "/data/saxsdb/sasbdb/entries/z4/sasdvz4/source/SASDVZ4.out",
      "size": 12897,
      "sha256": "b22b840d60be254e81da45fc80d49f8ba60849ffe978c9ad17b724dc1775e016",
      "role": "pddf"
    },
    {
      "status": "not_available",
      "url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDVZ4.sascif",
      "path": "/data/saxsdb/sasbdb/entries/z4/sasdvz4/source/SASDVZ4.sascif",
      "role": "sascif"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/zip_directories/SASDVZ4.zip",
      "path": "/data/saxsdb/sasbdb/entries/z4/sasdvz4/source/SASDVZ4.zip",
      "size": 6940,
      "sha256": "fc20f59d3b889959b3c7e41cd17f53fb243523ba29610967c762f88724a12d89",
      "role": "full_entry_zip",
      "zip_member_count": 2,
      "zip_validation": "central_directory_readable"
    }
  ]
}