Telomere DNA G-quadruplex (2JSL) at neutral pH

{
  "code": "SASDW53",
  "status": "Published",
  "type_of_curve": "SEC-SAS",
  "angular_unit": "1/A",
  "project": {
    "title": "Early events in G-quadruplex folding captured by time-resolved small-angle X-ray scattering.",
    "publication": {
      "title": "Early events in G-quadruplex folding captured by time-resolved small-angle X-ray scattering.",
      "author_list": "Monsen RC, Sabo TM, Gray R, Hopkins JB, Chaires JB",
      "journal": "Nucleic Acids Res",
      "doi": "10.1093/nar/gkaf043",
      "pmid": "39883009",
      "published_date": "2025 Jan 24"
    },
    "status": "released",
    "submitted_date": "2024-11-28",
    "released_date": "2025-02-10"
  },
  "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDW53.out",
  "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDW53.dat",
  "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDW53_dat_img.png",
  "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDW53_kratky_img.png",
  "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDW53_pofr_img.png",
  "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDW53_guinier_img.png",
  "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDW53.sascif",
  "experiment": {
    "instrument": {
      "detector": {
        "type": null,
        "name": "Pilatus3 X 1M",
        "resolution": 0.172
      },
      "name": "Advanced Photon Source (APS), Argonne National Laboratory",
      "city": "Lemont, IL",
      "country": "USA",
      "beamline_name": "BioCAT 18ID",
      "beam_geometry": null,
      "type_of_source": "X-ray synchrotron",
      "point_source": null,
      "line_collimation": null,
      "sample_path_length": null,
      "line_collimation_slitlength": null,
      "line_collimation_integrationwidth": null,
      "xray_energy": null,
      "beam_profile_ah": null,
      "beam_profile_al": null
    },
    "sample": {
      "molecule": [
        {
          "long_name": "Telomere DNA G-quadruplex Hybrid-2 form",
          "short_name": "2JSL",
          "sequence": "TAGGGTTAGGGTTAGGGTTAGGGTT",
          "organism": "synthetic construct",
          "uniprot_code": null,
          "uniprot_range_first": null,
          "uniprot_range_last": null,
          "oligomerization": "monomer",
          "molecular_type": "DNA",
          "uniprot_sequence": "",
          "mw": 7.959,
          "total_mw": 7.959,
          "number_molecules": 1,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": ""
        }
      ],
      "buffer": {
        "name": "6 mM Na2HPO4, 2 mM NaH2PO4, 1 mM Na2EDTA, 185 mM KCl",
        "concentration_unit": null,
        "comment": "BPEK buffer",
        "additive": null,
        "concentration": null,
        "pka": null,
        "ph": 7.2,
        "deuteration": null
      },
      "purity_method": null,
      "name": "Telomere DNA G-quadruplex (2JSL) at neutral pH",
      "ext_coefficient": null,
      "contrast": null,
      "specific_vol": null,
      "dry_vol": null,
      "absorbption": null,
      "deuteration": null,
      "mixture": null
    },
    "contributor": [
      {
        "affiliation": [
          {
            "short_name": null,
            "address": null,
            "full_name": "University of Louisville",
            "webpage": null
          }
        ],
        "contributor_name": "Robert",
        "contributor_surname": "Monsen",
        "orcid": "https://orcid.org/0000-0002-6283-3249"
      }
    ],
    "concentration_method": null,
    "concentration_unit": null,
    "date": "2020-08-11",
    "storage_temperature": 4.0,
    "cell_temperature": 22.0,
    "exposure_time": 0.5,
    "number_of_frames": 2,
    "wavelength": 0.1033,
    "sample_detector_distance": 3.655,
    "concentration_min": null,
    "concentration_max": 2.4,
    "sample_volume": 400.0,
    "flow_rate": 0.6,
    "s_min": 0.044,
    "s_max": 3.497,
    "total_exposure_time": null,
    "seccolumn": 1
  },
  "fits": [],
  "estimated_volume_method": null,
  "pddf_software": "ATSAS GNOM",
  "pddf_software_version": null,
  "i0_calibration_standard": null,
  "description": null,
  "experiment_description": "Synchrotron SAXS data from solutions of Telomere DNA G-quadruplex (2JSL) in 6 mM Na2HPO4, 2 mM NaH2PO4, 1 mM Na2EDTA, 185 mM KCl, pH 7.2 were collected on the BioCAT 18ID beam line at the Advanced Photon Source (APS), Argonne National Laboratory (Lemont, IL, USA) using a Pilatus3 X 1M detector at a sample-detector distance of 3.7 m and at a wavelength of λ = 0.1033 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). In-line size-exclusion chromatography (SEC) SAS was employed. The SEC parameters were as follows: A 400.00 μl sample at 2.4 mg/ml was injected at a 0.60 ml/min flow rate onto a GE Superdex 200 Increase 10/300 column at 22°C. Two successive 0.500 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.",
  "tags": [],
  "intensity_unit": "1/cm",
  "experimental_mw": 6.7,
  "experimental_mw_error": null,
  "guinier_i0_mw": null,
  "guinier_i0_mw_error": null,
  "porod_mw": null,
  "porod_mw_error": null,
  "pddf_i0": 0.01535,
  "pddf_i0_error": null,
  "guinier_i0": 0.0153208,
  "guinier_i0_error": null,
  "pddf_rg": 1.22,
  "pddf_rg_error": null,
  "guinier_rg": 1.213,
  "guinier_rg_error": 0.039,
  "pddf_dmax": 3.8,
  "pddf_dmax_error": null,
  "porod_volume": 8.3,
  "porod_volume_error": null,
  "estimated_volume": null,
  "estimated_volume_error": null,
  "guinier_point_first": 31,
  "guinier_point_last": 319,
  "pddf_point_first": null,
  "pddf_point_last": null,
  "i0_calibration_standard_data": null,
  "intensities_log_log_plot": "SASDW53_datloglog_img.png",
  "symmetry": null,
  "last_modified": "2025-02-10T15:31:54.646875+01:00",
  "bragg_peak": []
}

{
  "code": "SASDW53",
  "status": "success",
  "started_at": "2026-08-11T13:53:12.110584+00:00",
  "finished_at": "2026-08-11T13:53:19.930873+00:00",
  "source_last_modified": "2025-02-10T15:31:54.646875+01:00",
  "files": [
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/rest-api/entry/summary/SASDW53/",
      "path": "/data/saxsdb/sasbdb/entries/53/sasdw53/source/summary.json",
      "size": 6115,
      "sha256": "9edccf355b1965b40013661121f712777d4795700af19207c3b0a802bdf19035"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/intensities_files/SASDW53.dat",
      "path": "/data/saxsdb/sasbdb/entries/53/sasdw53/source/SASDW53.dat",
      "size": 59557,
      "sha256": "db360e55a934e427a11668f52e497ca02c1ef85604a4dd860447acde0068fa50",
      "role": "curve"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/p_of_R_files/SASDW53.out",
      "path": "/data/saxsdb/sasbdb/entries/53/sasdw53/source/SASDW53.out",
      "size": 103699,
      "sha256": "bfad58a4e0e23163c23e3edbd2e46bf35e9195cb37a8223c51386ecd84384d42",
      "role": "pddf"
    },
    {
      "status": "not_available",
      "url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDW53.sascif",
      "path": "/data/saxsdb/sasbdb/entries/53/sasdw53/source/SASDW53.sascif",
      "role": "sascif"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/zip_directories/SASDW53.zip",
      "path": "/data/saxsdb/sasbdb/entries/53/sasdw53/source/SASDW53.zip",
      "size": 48294,
      "sha256": "5542a4696393f540d6fd7b886e3a52286439f685fc24ad95276623d110dc85d9",
      "role": "full_entry_zip",
      "zip_member_count": 2,
      "zip_validation": "central_directory_readable"
    }
  ]
}