Class V GTP aptamer

{
  "code": "SASDWH4",
  "status": "Published",
  "type_of_curve": "Single concentration",
  "angular_unit": "1/nm",
  "project": {
    "title": "Crystal structure of the class V GTP-binding RNA aptamer bound to its ligand: GTP recognition by a topologically complex intermolecular G-quadruplex.",
    "publication": {
      "title": "Crystal structure of the class V GTP-binding RNA aptamer bound to its ligand: GTP recognition by a topologically complex intermolecular G-quadruplex.",
      "author_list": "Stafflinger H, Neißner K, Bartsch S, Pichler AK, Bartosik K, Dhamotharan K, Abele R, Duchardt-Ferner E, Micura R, Schindelin H, Wöhnert J",
      "journal": "Nucleic Acids Res",
      "doi": "10.1093/nar/gkaf1315",
      "pmid": "41422825",
      "published_date": "2025 Nov 26"
    },
    "status": "released",
    "submitted_date": "2025-01-13",
    "released_date": "2025-12-30"
  },
  "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDWH4.out",
  "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDWH4.dat",
  "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDWH4_dat_img.png",
  "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDWH4_kratky_img.png",
  "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDWH4_pofr_img.png",
  "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDWH4_guinier_img.png",
  "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDWH4.sascif",
  "experiment": {
    "instrument": {
      "detector": {
        "type": null,
        "name": "Pilatus 6M",
        "resolution": null
      },
      "name": "PETRA III",
      "city": "DESY; Hamburg",
      "country": "Germany",
      "beamline_name": "EMBL P12",
      "beam_geometry": null,
      "type_of_source": "X-ray synchrotron",
      "point_source": null,
      "line_collimation": null,
      "sample_path_length": null,
      "line_collimation_slitlength": null,
      "line_collimation_integrationwidth": null,
      "xray_energy": null,
      "beam_profile_ah": null,
      "beam_profile_al": null
    },
    "sample": {
      "molecule": [
        {
          "long_name": "Class V GTP aptamer apo",
          "short_name": null,
          "sequence": "GGGCGCAUUUUGGUAGGUCGGUCGCUGCUUCGGCAGUGAGGGGUAGGCAUUGCUGGCCUAGGGUGCCC",
          "organism": "Escherichia coli",
          "uniprot_code": null,
          "uniprot_range_first": null,
          "uniprot_range_last": null,
          "oligomerization": "unknown",
          "molecular_type": "RNA",
          "uniprot_sequence": "",
          "mw": 22.116,
          "total_mw": 22.116,
          "number_molecules": 0,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": ""
        }
      ],
      "buffer": {
        "name": "50 mM Bis-Tris, 50 mM KCl, 2 mM MgCl2",
        "concentration_unit": null,
        "comment": null,
        "additive": null,
        "concentration": null,
        "pka": null,
        "ph": 6.5,
        "deuteration": null
      },
      "purity_method": null,
      "name": "Class V GTP aptamer",
      "ext_coefficient": null,
      "contrast": null,
      "specific_vol": null,
      "dry_vol": null,
      "absorbption": null,
      "deuteration": null,
      "mixture": null
    },
    "contributor": [
      {
        "affiliation": [
          {
            "short_name": null,
            "address": null,
            "full_name": "Goethe University Frankfurt, Dept. Biosciences",
            "webpage": null
          }
        ],
        "contributor_name": "Helena",
        "contributor_surname": "Stafflinger",
        "orcid": "https://orcid.org/0009-0006-6219-9942"
      }
    ],
    "concentration_method": null,
    "concentration_unit": null,
    "date": "2024-07-19",
    "storage_temperature": 20.0,
    "cell_temperature": 20.0,
    "exposure_time": 0.095,
    "number_of_frames": 40,
    "wavelength": 0.123985,
    "sample_detector_distance": 3.0,
    "concentration_min": null,
    "concentration_max": 3.0,
    "sample_volume": null,
    "flow_rate": null,
    "s_min": 0.025,
    "s_max": 7.334,
    "total_exposure_time": null,
    "seccolumn": null
  },
  "fits": [],
  "estimated_volume_method": null,
  "pddf_software": "ATSAS GNOM",
  "pddf_software_version": "5.0",
  "i0_calibration_standard": null,
  "description": null,
  "experiment_description": "Synchrotron SAXS data from solutions of Class V GTP aptamer in 50 mM Bis-Tris, 50 mM KCl, 2 mM MgCl2, pH 6.5 were collected on the EMBL P12 beam line at PETRA III (DESY; Hamburg, Germany) using a Pilatus 6M detector at a sample-detector distance of 3 m and at a wavelength of λ = 0.123985 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). One solute concentration of 3.00 mg/ml was measured at 20°C. 40 successive 0.095 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.",
  "tags": [],
  "intensity_unit": "arbitrary",
  "experimental_mw": 55.6,
  "experimental_mw_error": null,
  "guinier_i0_mw": null,
  "guinier_i0_mw_error": null,
  "porod_mw": 45.0,
  "porod_mw_error": null,
  "pddf_i0": 0.1807,
  "pddf_i0_error": null,
  "guinier_i0": 0.540714,
  "guinier_i0_error": null,
  "pddf_rg": 3.365,
  "pddf_rg_error": null,
  "guinier_rg": 3.27,
  "guinier_rg_error": 0.07,
  "pddf_dmax": 15.27,
  "pddf_dmax_error": null,
  "porod_volume": 99.4,
  "porod_volume_error": null,
  "estimated_volume": null,
  "estimated_volume_error": null,
  "guinier_point_first": 21,
  "guinier_point_last": 103,
  "pddf_point_first": null,
  "pddf_point_last": null,
  "i0_calibration_standard_data": null,
  "intensities_log_log_plot": "SASDWH4_datloglog_img.png",
  "symmetry": null,
  "last_modified": "2025-12-30T13:43:06.434561+01:00",
  "bragg_peak": []
}

{
  "code": "SASDWH4",
  "status": "success",
  "started_at": "2026-08-11T14:24:24.556613+00:00",
  "finished_at": "2026-08-11T14:24:32.751552+00:00",
  "source_last_modified": "2025-12-30T13:43:06.434561+01:00",
  "files": [
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/rest-api/entry/summary/SASDWH4/",
      "path": "/data/saxsdb/sasbdb/entries/h4/sasdwh4/source/summary.json",
      "size": 6054,
      "sha256": "e31f4652dd5c474f863faed0208c2a42e683c6571a4df78708ace020977a71c4"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/intensities_files/SASDWH4.dat",
      "path": "/data/saxsdb/sasbdb/entries/h4/sasdwh4/source/SASDWH4.dat",
      "size": 120393,
      "sha256": "e3f3eb9d435758fbe77a288580a984abae2cc835cd6caf58ea6d530ff9615edb",
      "role": "curve"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/p_of_R_files/SASDWH4.out",
      "path": "/data/saxsdb/sasbdb/entries/h4/sasdwh4/source/SASDWH4.out",
      "size": 77401,
      "sha256": "ddd766aaa91e2c90215131c238126e6cf7ba0ce591d4fcd75ca94a517fd25db7",
      "role": "pddf"
    },
    {
      "status": "not_available",
      "url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDWH4.sascif",
      "path": "/data/saxsdb/sasbdb/entries/h4/sasdwh4/source/SASDWH4.sascif",
      "role": "sascif"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/zip_directories/SASDWH4.zip",
      "path": "/data/saxsdb/sasbdb/entries/h4/sasdwh4/source/SASDWH4.zip",
      "size": 54572,
      "sha256": "e8f19bc56b92b77f44a23df45cf207feab330dbd0676c307e599dacae1f504dc",
      "role": "full_entry_zip",
      "zip_member_count": 2,
      "zip_validation": "central_directory_readable"
    }
  ]
}