The following content comes directly from the SASBDB entry. Missing values are shown as “—”; SAXSdb does not infer undeclared units.
Every source field is expanded here, including empty values, list members and fields already shown above.
View the complete summary.json source
{
"code": "SASDWJ4",
"status": "Published",
"type_of_curve": "Single concentration",
"angular_unit": "1/nm",
"project": {
"title": "Crystal structure of the class V GTP-binding RNA aptamer bound to its ligand: GTP recognition by a topologically complex intermolecular G-quadruplex.",
"publication": {
"title": "Crystal structure of the class V GTP-binding RNA aptamer bound to its ligand: GTP recognition by a topologically complex intermolecular G-quadruplex.",
"author_list": "Stafflinger H, Neißner K, Bartsch S, Pichler AK, Bartosik K, Dhamotharan K, Abele R, Duchardt-Ferner E, Micura R, Schindelin H, Wöhnert J",
"journal": "Nucleic Acids Res",
"doi": "10.1093/nar/gkaf1315",
"pmid": "41422825",
"published_date": "2025 Nov 26"
},
"status": "released",
"submitted_date": "2025-01-13",
"released_date": "2025-12-30"
},
"pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDWJ4.out",
"intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDWJ4.dat",
"intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDWJ4_dat_img.png",
"intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDWJ4_kratky_img.png",
"pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDWJ4_pofr_img.png",
"intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDWJ4_guinier_img.png",
"sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDWJ4.sascif",
"experiment": {
"instrument": {
"detector": {
"type": null,
"name": "Pilatus 6M",
"resolution": null
},
"name": "PETRA III",
"city": "DESY; Hamburg",
"country": "Germany",
"beamline_name": "EMBL P12",
"beam_geometry": null,
"type_of_source": "X-ray synchrotron",
"point_source": null,
"line_collimation": null,
"sample_path_length": null,
"line_collimation_slitlength": null,
"line_collimation_integrationwidth": null,
"xray_energy": null,
"beam_profile_ah": null,
"beam_profile_al": null
},
"sample": {
"molecule": [
{
"long_name": "Class V GTP aptamer",
"short_name": null,
"sequence": "GGGCGCAUUUUGGUAGGUCGGUCGCUGCUUCGGCAGUGAGGGGUAGGCAUUGCUGGCCUAGGGUGCCC",
"organism": "Escherichia coli",
"uniprot_code": null,
"uniprot_range_first": null,
"uniprot_range_last": null,
"oligomerization": "monomer",
"molecular_type": "RNA",
"uniprot_sequence": "",
"mw": 22.116,
"total_mw": 22.116,
"number_molecules": 1,
"complex_state": false,
"deuteration": null,
"molecule_source": "biological",
"molecule_description": ""
},
{
"long_name": "Guanosine triphosphate",
"short_name": "GTP",
"sequence": "C10H16N5O14P3",
"organism": null,
"uniprot_code": null,
"uniprot_range_first": null,
"uniprot_range_last": null,
"oligomerization": "monomer",
"molecular_type": "other",
"uniprot_sequence": "",
"mw": 0.523,
"total_mw": 0.523,
"number_molecules": 1,
"complex_state": false,
"deuteration": null,
"molecule_source": "biological",
"molecule_description": ""
}
],
"buffer": {
"name": "50 mM Bis-Tris, 50 mM KCl, 2 mM MgCl2",
"concentration_unit": null,
"comment": null,
"additive": null,
"concentration": null,
"pka": null,
"ph": 6.5,
"deuteration": null
},
"purity_method": null,
"name": "Class V GTP aptamer complex with GTP",
"ext_coefficient": null,
"contrast": null,
"specific_vol": null,
"dry_vol": null,
"absorbption": null,
"deuteration": null,
"mixture": null
},
"contributor": [
{
"affiliation": [
{
"short_name": null,
"address": null,
"full_name": "Goethe University Frankfurt, Dept. Biosciences",
"webpage": null
}
],
"contributor_name": "Helena",
"contributor_surname": "Stafflinger",
"orcid": "https://orcid.org/0009-0006-6219-9942"
}
],
"concentration_method": null,
"concentration_unit": null,
"date": "2024-07-19",
"storage_temperature": 20.0,
"cell_temperature": 20.0,
"exposure_time": 0.095,
"number_of_frames": 40,
"wavelength": 0.123985,
"sample_detector_distance": 3.0,
"concentration_min": null,
"concentration_max": 6.0,
"sample_volume": null,
"flow_rate": null,
"s_min": 0.022,
"s_max": 7.334,
"total_exposure_time": null,
"seccolumn": null
},
"fits": [
{
"models": [
{
"model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDWJ4_fit1_model1_img.png",
"software": "DAMMIN",
"pdb_link": [],
"model_title": null,
"type_of_model": "dummy",
"software_version": "3.2.1",
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDWJ4_fit1_model1.cif",
"model_mw": null,
"bead_radius": null,
"log": "https://www.sasbdb.org/media/log_files/ClassV6m_1.log",
"symmetry": null,
"comment": null,
"user": 1168
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDWJ4_fit1_fixed_fit_img.png",
"software": "CRYSOL",
"chi_square_value": 1.216,
"p_value": 0.0,
"fit_residual_plot": "SASDWJ4_fit1_fitresiduals_img.png",
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDWJ4_fit1.fit",
"fit_log": "https://www.sasbdb.org/media/fitting_files/log_files/HSsample04_HSB02_0044_ClassV6m_1-1.log",
"software_version": "3.2.1",
"description": ""
},
{
"models": [
{
"model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDWJ4_fit2_model1_img.png",
"software": "Coot",
"pdb_link": [],
"model_title": null,
"type_of_model": "atomic",
"software_version": null,
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDWJ4_fit2_model1.pdb",
"model_mw": 22.25,
"bead_radius": null,
"log": null,
"symmetry": null,
"comment": null,
"user": 1168
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDWJ4_fit2_fixed_fit_img.png",
"software": "CRYSOL",
"chi_square_value": 10.774,
"p_value": 0.0,
"fit_residual_plot": "SASDWJ4_fit2_fitresiduals_img.png",
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDWJ4_fit2.fit",
"fit_log": "https://www.sasbdb.org/media/fitting_files/log_files/ClassV_SAXS_HSsample04_HSB02_0044_Ivk1Xix.log",
"software_version": "3.2.1",
"description": ""
}
],
"estimated_volume_method": null,
"pddf_software": "ATSAS GNOM",
"pddf_software_version": "5.0",
"i0_calibration_standard": null,
"description": null,
"experiment_description": "Synchrotron SAXS data from solutions of Class V GTP aptamer complex with GTP in 50 mM Bis-Tris, 50 mM KCl, 2 mM MgCl2, pH 6.5 were collected on the EMBL P12 beam line at PETRA III (DESY; Hamburg, Germany) using a Pilatus 6M detector at a sample-detector distance of 3 m and at a wavelength of λ = 0.123985 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). One solute concentration of 6.00 mg/ml was measured at 20°C. 40 successive 0.095 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.",
"tags": [],
"intensity_unit": "arbitrary",
"experimental_mw": 24.4,
"experimental_mw_error": null,
"guinier_i0_mw": null,
"guinier_i0_mw_error": null,
"porod_mw": 20.4,
"porod_mw_error": null,
"pddf_i0": 0.09546,
"pddf_i0_error": null,
"guinier_i0": 0.56766,
"guinier_i0_error": null,
"pddf_rg": 2.273,
"pddf_rg_error": null,
"guinier_rg": 2.22,
"guinier_rg_error": 0.03,
"pddf_dmax": 7.56,
"pddf_dmax_error": null,
"porod_volume": 33.6,
"porod_volume_error": null,
"estimated_volume": null,
"estimated_volume_error": null,
"guinier_point_first": 67,
"guinier_point_last": 201,
"pddf_point_first": null,
"pddf_point_last": null,
"i0_calibration_standard_data": null,
"intensities_log_log_plot": "SASDWJ4_datloglog_img.png",
"symmetry": null,
"last_modified": "2025-12-30T13:43:49.298206+01:00",
"bragg_peak": []
}
