1co0

NMR STUDY OF TRP REPRESSOR-MTR OPERATOR DNA COMPLEX

Method: SOLUTION NMR D_max: 72.7 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

TRP OPERON REPRESSOR

Escherichia coli

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 2 DNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 1–107 Chain B； UniProt 1–107	Not recorded	5'-D(TPGPTPAPCPTPCPGPTPGPTPAPCPTPGPGPTPAPCPA)-3' × 1 5'-D(TPGPTPAPCPCPAPGPTPAPCPAPCPGPAPGPTPAPCPA)-3' × 1 TRP TRYPTOPHAN × 2	SOLUTION NMR NMR measurement conditions：pH 5.7	Resolution not provided

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1CO0	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1JHG TRP REPRESSOR MUTANT V58I Deposited 1996-07-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 7–107（101 aa）	Mutation：CHAIN A, V58I	PO4 PHOSPHATE ION × 2 TRP TRYPTOPHAN × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5；HANGING DROP VAPOR DIFFUSION 2.0 M SODIUM PHOSPHATE, PH 5.0 600 MM AMMONIUM CHLORIDE 5 MM L-TRYPTOPHAN, vapor diffusion - hanging drop	Resolution 1.30 Å R-free 0.172
1MI7 Crystal Structure of Domain Swapped trp Aporepressor in 30%(v/v) Isopropanol Deposited 2002-08-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain R 1–107（107 aa）	Not recorded	IPA ISOPROPYL ALCOHOL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；295 K；100 mM Na HEPES, 100 mM sodium chloride, 30%(v/v) isopropanol, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 2.50 Å R-free 0.288
1RCS NMR STUDY OF TRP REPRESSOR-OPERATOR DNA COMPLEX Deposited 1995-05-12	Different construct Different experimental conditions	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 3–106（104 aa） Chain B 3–106（104 aa）	Not recorded	TRP TRYPTOPHAN × 2	SOLUTION NMR mmCIF provides none of the parsed conditions	Resolution not provided
1TRO CRYSTAL STRUCTURE OF TRP REPRESSOR OPERATOR COMPLEX AT ATOMIC RESOLUTION Deposited 1992-08-30	Different construct Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 0–107（108 aa） Chain C 0–107（108 aa）	Not recorded	TRP TRYPTOPHAN × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；VAPOR DIFFUSION	Resolution 1.90 Å
1TRO CRYSTAL STRUCTURE OF TRP REPRESSOR OPERATOR COMPLEX AT ATOMIC RESOLUTION Deposited 1992-08-30	Different construct Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain E 0–107（108 aa） Chain G 0–107（108 aa）	Not recorded	TRP TRYPTOPHAN × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；VAPOR DIFFUSION	Resolution 1.90 Å
1TRR TANDEM BINDING IN CRYSTALS OF A TRP REPRESSOR/OPERATOR HALF-SITE COMPLEX Deposited 1993-10-21	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 1–107（107 aa） Chain B 1–107（107 aa） Chain G 1–107（107 aa） Chain H 1–107（107 aa）	Not recorded	TRP TRYPTOPHAN × 4	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.40 Å
1TRR TANDEM BINDING IN CRYSTALS OF A TRP REPRESSOR/OPERATOR HALF-SITE COMPLEX Deposited 1993-10-21	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 4 PDB declaration: hexameric	Chain D 1–107（107 aa） Chain E 1–107（107 aa） Chain J 1–107（107 aa） Chain K 1–107（107 aa）	Not recorded	TRP TRYPTOPHAN × 4	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.40 Å
1WRP FLEXIBILITY OF THE DNA-BINDING DOMAINS OF TRP REPRESSOR Deposited 1987-12-01	Different construct Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain R 1–107（107 aa）	Not recorded	TRP TRYPTOPHAN × 2	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.20 Å
1WRS NMR STUDY OF HOLO TRP REPRESSOR Deposited 1995-05-12	Different construct Different oligomeric state Different experimental conditions	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain R 3–107（105 aa） Chain S 3–107（105 aa）	Not recorded	TRP TRYPTOPHAN × 2	SOLUTION NMR mmCIF provides none of the parsed conditions	Resolution not provided
1WRT NMR STUDY OF APO TRP REPRESSOR Deposited 1995-05-12	Different construct Different oligomeric state Different ligand/ion Different experimental conditions	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain R 3–107（105 aa） Chain S 3–107（105 aa）	Not recorded	No recorded non-water small molecule	SOLUTION NMR mmCIF provides none of the parsed conditions	Resolution not provided
1ZT9 E. coli trp repressor, tetragonal crystal form Deposited 2005-05-26	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–107（107 aa） Chain B 1–107（107 aa）	Not recorded	SO4 SULFATE ION × 4 TRP TRYPTOPHAN × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.6；294 K；2.8 M ammonium sulfate plus 50 mM sodium, potassium phosphate buffer, 5 mM L-tryptophan, VAPOR DIFFUSION, HANGING DROP, temperature 294K, pH 5.60	Resolution 2.00 Å R-free 0.219
1ZT9 E. coli trp repressor, tetragonal crystal form Deposited 2005-05-26	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain D 1–107（107 aa） Chain E 1–107（107 aa）	Not recorded	SO4 SULFATE ION × 4 TRP TRYPTOPHAN × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.6；294 K；2.8 M ammonium sulfate plus 50 mM sodium, potassium phosphate buffer, 5 mM L-tryptophan, VAPOR DIFFUSION, HANGING DROP, temperature 294K, pH 5.60	Resolution 2.00 Å R-free 0.219
1ZT9 E. coli trp repressor, tetragonal crystal form Deposited 2005-05-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 3 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 1–107（107 aa） Chain B 1–107（107 aa） Chain D 1–107（107 aa） Chain E 1–107（107 aa）	Not recorded	SO4 SULFATE ION × 8 TRP TRYPTOPHAN × 4	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.6；294 K；2.8 M ammonium sulfate plus 50 mM sodium, potassium phosphate buffer, 5 mM L-tryptophan, VAPOR DIFFUSION, HANGING DROP, temperature 294K, pH 5.60	Resolution 2.00 Å R-free 0.219
1ZT9 E. coli trp repressor, tetragonal crystal form Deposited 2005-05-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 4 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 1–107（107 aa） Chain B 1–107（107 aa） Chain D 1–107（107 aa） Chain E 1–107（107 aa）	Not recorded	SO4 SULFATE ION × 8 TRP TRYPTOPHAN × 4	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.6；294 K；2.8 M ammonium sulfate plus 50 mM sodium, potassium phosphate buffer, 5 mM L-tryptophan, VAPOR DIFFUSION, HANGING DROP, temperature 294K, pH 5.60	Resolution 2.00 Å R-free 0.219
1ZT9 E. coli trp repressor, tetragonal crystal form Deposited 2005-05-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 5 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 1–107（107 aa） Chain B 1–107（107 aa） Chain D 1–107（107 aa） Chain E 1–107（107 aa）	Not recorded	SO4 SULFATE ION × 8 TRP TRYPTOPHAN × 4	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.6；294 K；2.8 M ammonium sulfate plus 50 mM sodium, potassium phosphate buffer, 5 mM L-tryptophan, VAPOR DIFFUSION, HANGING DROP, temperature 294K, pH 5.60	Resolution 2.00 Å R-free 0.219
2OZ9 E. coli TRP holorepressor, orthorhombic crystal form Deposited 2007-02-25	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain R 2–108（107 aa）	Not recorded	NA SODIUM ION × 2 SO4 SULFATE ION × 2 TRP TRYPTOPHAN × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 5；298 K；crystallization conditions: 2.5 M sodium phosphate, 0.6 M ammonium chloride, 2.5 mM L-tryptophan. Prior to data collection the crystal was equilibrated to 2.4 M ammonium sulfate, 0.4 M sodium chloride, 2.4 mM L-tryptophan, 50 mM sodium acetate., pH 5.0, VAPOR DIFFUSION, temperature 298K	Resolution 1.65 Å
3SSW E. coli trp aporepressor Deposited 2011-07-08	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain N 2–108（107 aa） Chain R 2–108（107 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；294 K；Hampton Research Crystal Screen condition #6: 30% (w/v) PEG 4000, 200 mM MgCl2, 100 mM Tris HCl pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 294K	Resolution 1.67 Å R-free 0.219
3SSX E. coli trp aporeporessor L75F mutant Deposited 2011-07-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain N 2–108（107 aa） Chain R 2–108（107 aa）	Mutation：L75F Mutation：L75F	TAM TRIS(HYDROXYETHYL)AMINOMETHANE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；294 K；Hampton Research Crystal Screen condition #6: 30% (w/v) PEG 4000, 200 mM MgCl2, 100 mM Tris HCl pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 294K	Resolution 1.58 Å R-free 0.218
3WRP FLEXIBILITY OF THE DNA-BINDING DOMAINS OF TRP REPRESSOR Deposited 1987-12-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–107（107 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 1.80 Å
6EJW Tryptophan Repressor TrpR from E.coli wildtype with Indole-3-acetic acid as ligand Deposited 2017-09-23	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–108（108 aa） Chain B 1–108（108 aa）	Not recorded	IAC 1H-INDOL-3-YLACETIC ACID × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.5；293 K；0.1 M Bis-Tris pH 5.5 2 M Ammonium sulfate	Resolution 1.99 Å R-free 0.243
6EJW Tryptophan Repressor TrpR from E.coli wildtype with Indole-3-acetic acid as ligand Deposited 2017-09-23	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 1–108（108 aa） Chain D 1–108（108 aa）	Not recorded	IAC 1H-INDOL-3-YLACETIC ACID × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.5；293 K；0.1 M Bis-Tris pH 5.5 2 M Ammonium sulfate	Resolution 1.99 Å R-free 0.243
6EKP Tryptophan Repressor TrpR from E.coli variant T44L T81M S88Y with Indole-3-acetic acid as ligand Deposited 2017-09-26	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–108（108 aa） Chain B 1–108（108 aa）	Not recorded	IAC 1H-INDOL-3-YLACETIC ACID × 2 P3G 3,6,9,12,15-PENTAOXAHEPTADECANE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；293 K；0.05 Calcium Chloride 0.1M Bis-Tris pH 6.5 30% PEG 550 MME	Resolution 1.46 Å R-free 0.190
6ELB Tryptophan Repressor TrpR from E.coli variant M42F T44L T81M N87G S88Y with Indole-3-acetic acid as ligand Deposited 2017-09-28	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–108（108 aa） Chain B 1–108（108 aa）	Not recorded	IAC 1H-INDOL-3-YLACETIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；293 K；25% PEG 3350 0.17M KCl 3% D-(+) Trehalose dihydrate	Resolution 1.44 Å R-free 0.193
6ELF Tryptophan Repressor TrpR from E.coli variant M42F T44L T81I S88Y with Indole-3-acetic acid as ligand Deposited 2017-09-28	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–108（108 aa） Chain B 1–108（108 aa）	Not recorded	IAC 1H-INDOL-3-YLACETIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；293 K；0.1M MES pH 6.5 12 % PEG 20000	Resolution 1.83 Å R-free 0.217
6ELG Tryptophan Repressor TrpR from E.coli variant M42F T44L T81I S88Y with Indole-3-acetonitrile Deposited 2017-09-28	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–108（108 aa） Chain B 1–108（108 aa）	Not recorded	3BO 1H-indol-3-ylacetonitrile × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；293 K；0.2 M Ammonium Formate 20% PEG 3350	Resolution 1.38 Å R-free 0.176
6ENI Tryptophan Repressor TrpR from E.coli variant T44L S88Y with Indole-3-acetic acid as ligand Deposited 2017-10-04	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–108（108 aa） Chain B 1–108（108 aa）	Not recorded	IAC 1H-INDOL-3-YLACETIC ACID × 2 EDO 1,2-ETHANEDIOL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 4；293 K；0.1 M MMT buffer pH 4 25 % PEG 1500	Resolution 1.10 Å R-free 0.175
6ENN Tryptophan Repressor TrpR from E.coli variant T44L T81M N87G S88Y with Indole-3-acetic acid as ligand Deposited 2017-10-05	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–108（108 aa） Chain B 1–108（108 aa）	Not recorded	IAC 1H-INDOL-3-YLACETIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5；293 K；0.1 M MMT buffer pH 5 25 % PEG 1500	Resolution 1.17 Å R-free 0.180
6F7F Tryptophan Repressor TrpR from E.coli with 3-Indolepropionic acid Deposited 2017-12-08	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 4–106（103 aa） Chain B 4–106（103 aa）	Not recorded	IOP INDOLYLPROPIONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；293 K；0.2 M Calcium Chloride 0.1 M HEPES pH7.5 30% PEG 4000	Resolution 2.13 Å R-free 0.229
6F7F Tryptophan Repressor TrpR from E.coli with 3-Indolepropionic acid Deposited 2017-12-08	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 4–106（103 aa） Chain D 4–106（103 aa）	Not recorded	IOP INDOLYLPROPIONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；293 K；0.2 M Calcium Chloride 0.1 M HEPES pH7.5 30% PEG 4000	Resolution 2.13 Å R-free 0.229
6F7G Tryptophan Repressor TrpR from E.coli with 5-Methyltryptamine Deposited 2017-12-08	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 4–106（103 aa） Chain C 4–106（103 aa）	Not recorded	CVW 2-(5-methyl-1~{H}-indol-3-yl)ethanamine × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；0.2 Sodium Chloride 0.1 M HEPES pH7.5 25% PEG 3350	Resolution 1.66 Å R-free 0.226
6F9K Tryptophan Repressor TrpR from E.coli with 5-methyl-L-tryptophan as ligand Deposited 2017-12-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–107（107 aa）	Not recorded	D0Q 5-methyl-L-tryptophan × 8 SO4 SULFATE ION × 8	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 4；293 K；0.1M Citric acid pH3.5, 2.4M Ammonium sulfate, pH4.0 cryo: +25% glycerol	Resolution 1.40 Å R-free 0.206
6FAL Tryptophan Repressor TrpR from E.coli with 3-Indolepropionic acid as ligand Deposited 2017-12-15	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 2–108（107 aa） Chain B 2–108（107 aa）	Not recorded	IOP INDOLYLPROPIONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.5；293 K；0.2M MgCl2 0.1M Tris HCl, pH8.5 30% PEG 4000	Resolution 1.20 Å R-free 0.179
6ST6 Crystal Structure of Domain Swapped Trp Repressor V58I Variant Deposited 2019-09-10	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–105（105 aa）	Mutation：V58I	IPA ISOPROPYL ALCOHOL × 12	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；293 K；100 mM Na HEPES, 100 mM sodium chloride, 27.5-35%(v/v) isopropanol, pH 7.5	Resolution 2.05 Å R-free 0.311
6ST7 Crystal Structure of Domain Swapped Trp Repressor V58I Variant with bound L-trp Deposited 2019-09-10	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–105（105 aa）	Mutation：V58I	TRP TRYPTOPHAN × 2 IPA ISOPROPYL ALCOHOL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；293 K；100 mM Na HEPES, 100 mM sodium chloride, 27.5-35%(v/v) isopropanol, pH 7.5	Resolution 2.45 Å R-free 0.287

26 other PDB entries and 34 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	TRPR_ECOLI
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–107； UniProt 1–107 Author chain B； PDBConstruct 1–107； UniProt 1–107

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1co0
Deposition date deposition_date	1999-05-30
Structure title title	NMR STUDY OF TRP REPRESSOR-MTR OPERATOR DNA COMPLEX
Keywords keywords	TRANSCRIPTION REGULATION, REPRESSOR, DNA-BINDING, TRP, DNA, TRANSCRIPTION; TRANSCRIPTION
Experimental Method method	SOLUTION NMR

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	21.60 Å
Radius of gyration Rg (electron density) rg_electron	20.94 Å
Forward intensity I(0) i0	6363780000.00
Molecular weight molecular_weight	550820.0 kDa
Excluded volume excluded_volume	637150 Å³
Envelope volume envelope_volume	100500 Å³
Hydration-shell volume shell_volume	32467 Å³
Envelope diameter envelope_diameter	91.5 Å
Shell Rg shell_rg	33.47 Å
Envelope Rg envelope_rg	25.86 Å
Shape Rg shape_rg	20.87 Å
Total Rg total_rg	21.27 Å
Total atoms total_atoms	70845
Residues n_residues	3750
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	72.7 Å
Rg (real space) rg_real	21.57 Å
Rg uncertainty (real space) rg_real_error	0.54 Å
I(0) (real space) i0_real	6.3640e+09
I(0) uncertainty (real space) i0_real_error	9.1950e+07
Rg (reciprocal space) rg_reciprocal	21.58 Å
I(0) (reciprocal space) i0_reciprocal	6364000000.0000
Solution quality estimate total_estimate	0.8108
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	3
Primary peak position r_peak_primary	26.7 Å
Skewness Skewness skewness	0.275
Kurtosis Kurtosis kurtosis	-0.432
Angular range angular_range	— – 0.3700 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	5638000.0000
Real-space data points n_real_points	69
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.861; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.953; Smooth: 0.000

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	5'-D(TPGPTPAPCPTPCPGPTPGPTPAPCPTPGPGPTPAPCPA)-3'
Molecular weight formula_weight	6140.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E
Atom count atom_count	70845

TGTACTCGTGTACTGGTACA

Entity 2 Entity 2 polymer

Description description	5'-D(TPGPTPAPCPCPAPGPTPAPCPAPCPGPAPGPTPAPCPA)-3'
Molecular weight formula_weight	6127.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F

TGTACCAGTACACGAGTACA

Entity 3 Entity 3 polymer

Description description	TRP OPERON REPRESSOR
Molecular weight formula_weight	12238.9 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

AQQSPYSAAMAEQRHQEWLRFVDLLKNAYQNDLHLPLLNLMLTPDEREALGTRVRIVEELLRGEMSQRELKNELGAGIATITRGSNSLKAAPVELRQWLEEVLLKSD

来源 Source

来源生物 organism	Escherichia coli
NCBI Class编号 ncbi_taxonomy_id	562
宿主生物 host_organism	Escherichia coli

Entity 4 Entity 4 non-polymer

Description description	TRYPTOPHAN
Molecular weight formula_weight	204.2 kDa
Source method src_method	syn
Copy count entity_count	2

▼

7. Fold Classification (SCOP + CATH) 4 domains

SCOP 2.08 (2 domains)

Domain ID domain_id	d1co0a_
Class class	a — All alpha proteins
Fold Fold fold	a.4 — DNA/RNA-binding 3-helical bundle
Superfamily Superfamily superfamily	a.4.12 — TrpR-like
Family Family family	a.4.12.1 — Trp repressor, TrpR

Domain ID domain_id	d1co0b_
Class class	a — All alpha proteins
Fold Fold fold	a.4 — DNA/RNA-binding 3-helical bundle
Superfamily Superfamily superfamily	a.4.12 — TrpR-like
Family Family family	a.4.12.1 — Trp repressor, TrpR

CATH v4.4 (2 domains)

Domain ID domain_id	1co0A00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1270 — Trp Operon Repressor; Chain A
Homologous superfamily homologous superfamily	10 — TrpR-like

Domain ID domain_id	1co0B00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1270 — Trp Operon Repressor; Chain A
Homologous superfamily homologous superfamily	10 — TrpR-like

▶

8. Citations (3)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	1

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

fit	/app/data/saxs_computation/co/1co0/1co0.fit
pddf	/app/data/pr_computation/co/1co0/1co0.pr.out
profile	/app/data/saxs_computation/co/1co0/1co0.dat

NMR STUDY OF TRP REPRESSOR-MTR OPERATOR DNA COMPLEX

1. Protein Identity and Related Structures Protein Identity & Related Structures

TRP OPERON REPRESSOR

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

来源 Source

Entity 4 Entity 4 non-polymer

7. Fold Classification (SCOP + CATH) 4 domains

SCOP 2.08 (2 domains)

CATH v4.4 (2 domains)

8. Citations (3)

9. Files and Curves (10)

Files (7)

Curves (3)