1efw

Crystal structure of aspartyl-tRNA synthetase from Thermus thermophilus complexed to tRNAasp from Escherichia coli

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

ASPARTYL-TRNA SYNTHETASE

Thermus thermophilus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	ASPARTYL-TRNA × 1 water × 2	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 1	ASPARTYL-TRNA × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYD_THETH
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–580； UniProt 1–580 Author chain B； PDBConstruct 1–580； UniProt 1–580

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1efw
Deposition date deposition_date	2000-02-10
Structure title title	Crystal structure of aspartyl-tRNA synthetase from Thermus thermophilus complexed to tRNAasp from Escherichia coli
Keywords keywords	ASPARTYL-TRNA SYNTHETASE, TRNA, PROTEIN-RNA COMPLEX, LIGASE/RNA, LIGASE-RNA complex; LIGASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1efw__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1efw__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1efw__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	32.93 Å
Rg (electron density)	32.27 Å
Total Rg	32.80 Å
Atom count	6238
Residues	643
Excluded volume	105460 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1efw__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`1efw__assembly_2__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	ASPARTYL-TRNA
Molecular weight formula_weight	23724.3 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C,D
Atom count atom_count	12572

GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUGUCACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCC

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	ASPARTYL-TRNA SYNTHETASE
Molecular weight formula_weight	66124.8 kDa
EC 编号 ec_number	6.1.1.12
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

MRRTHYAGSLRETHVGEEVVLEGWVNRRRDLGGLIFLDLRDREGLVQLVAHPASPAYATAERVRPEWVVRAKGLVRLRPEPNPRLATGRVEVELSALEVLAEAKTPPFPVDAGWRGEEEKEASEELRLKYRYLDLRRRRMQENLRLRHRVIKAIWDFLDREGFVQVETPFLTKSTPEGARDFLVPYRHEPGLFYALPQSPQLFKQMLMVAGLDRYFQIARCFRDEDLRADRQPDFTQLDLEMSFVEVEDVLELNERLMAHVFREALGVELPLPFPRLSYEEAMERYGSDKPDLRFGLELKEVGPLFRQSGFRVFQEAESVKALALPKALSRKEVAELEEVAKRHKAQGLAWARVEEGGFSGGVAKFLEPVREALLQATEARPGDTLLFVAGPRKVAATALGAVRLRAADLLGLKREGFRFLWVVDFPLLEWDEEEEAWTYMHHPFTSPHPEDLPLLEKDPGRVRALAYDLVLNGVEVGGGSIRIHDPRLQARVFRLLGIGEEEQREKFGFFLEALEYGAPPHGGIAWGLDRLLALMTGSPSIREVIAFPKNKEGKDPLTGAPSPVPEEQLRELGLMVVRP

Source Source

Source organism organism	Thermus thermophilus
NCBI taxonomy ID ncbi_taxonomy_id	274
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	96

▼

6. Fold Classification (SCOP + CATH) 12 domains

SCOP 2.08 (6 domains)

Domain ID domain_id	d1efwa1
Class class	b — All beta proteins
Fold Fold fold	b.40 — OB-fold
Superfamily Superfamily superfamily	b.40.4 — Nucleic acid-binding proteins
Family Family family	b.40.4.1 — Anticodon-binding domain

Domain ID domain_id	d1efwa2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.74 — DCoH-like
Superfamily Superfamily superfamily	d.74.4 — GAD domain-like
Family Family family	d.74.4.1 — GAD domain

Domain ID domain_id	d1efwa3
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.104 — Class II aaRS and biotin synthetases
Superfamily Superfamily superfamily	d.104.1 — Class II aaRS and biotin synthetases
Family Family family	d.104.1.1 — Class II aminoacyl-tRNA synthetase (aaRS)-like, catalytic domain

Domain ID domain_id	d1efwb1
Class class	b — All beta proteins
Fold Fold fold	b.40 — OB-fold
Superfamily Superfamily superfamily	b.40.4 — Nucleic acid-binding proteins
Family Family family	b.40.4.1 — Anticodon-binding domain

Domain ID domain_id	d1efwb2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.74 — DCoH-like
Superfamily Superfamily superfamily	d.74.4 — GAD domain-like
Family Family family	d.74.4.1 — GAD domain

Domain ID domain_id	d1efwb3
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.104 — Class II aaRS and biotin synthetases
Superfamily Superfamily superfamily	d.104.1 — Class II aaRS and biotin synthetases
Family Family family	d.104.1.1 — Class II aminoacyl-tRNA synthetase (aaRS)-like, catalytic domain

CATH v4.4 (6 domains)

Domain ID domain_id	1efwA01
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	140 — Nucleic acid-binding proteins

Domain ID domain_id	1efwA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	930 — BirA Bifunctional Protein; domain 2
Homologous superfamily homologous superfamily	10 — Bira Bifunctional Protein; Domain 2

Domain ID domain_id	1efwA03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	1360 — Gyrase A; domain 2
Homologous superfamily homologous superfamily	30 — GAD-like domain

Domain ID domain_id	1efwB01
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	140 — Nucleic acid-binding proteins

Domain ID domain_id	1efwB02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	930 — BirA Bifunctional Protein; domain 2
Homologous superfamily homologous superfamily	10 — Bira Bifunctional Protein; Domain 2

Domain ID domain_id	1efwB03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	1360 — Gyrase A; domain 2
Homologous superfamily homologous superfamily	30 — GAD-like domain

▶

Unit-cell length a length_a	251.450 Å
Unit-cell length b length_b	251.450 Å
Unit-cell length c length_c	88.700 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	12

Space group space_group	P 63
Space-group number int_tables_number	173
Crystal system crystal_system	—

Resolution resolution	3.000 Å
Low-resolution limit resolution_low	15.000 Å
R factor r_factor	0.2480
R_work r_work	0.2480
R_free r_free	0.2930

Crystal structure of aspartyl-tRNA synthetase from Thermus thermophilus complexed to tRNAasp from Escherichia coli

1. Protein Identity and Related Structures Protein Identity & Related Structures

ASPARTYL-TRNA SYNTHETASE

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1efw__assembly_1__model_1

1efw__assembly_1__model_1 | I(q)

1efw__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 water

6. Fold Classification (SCOP + CATH) 12 domains

SCOP 2.08 (6 domains)

CATH v4.4 (6 domains)

7. Citations (1)

Crystal structure of aspartyl-tRNA synthetase from Thermus thermophilus complexed to tRNAasp from Escherichia coli

1. Protein Identity and Related Structures Protein Identity & Related Structures

ASPARTYL-TRNA SYNTHETASE

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1efw__assembly_1__model_1

1efw__assembly_1__model_1 | I(q)

1efw__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 water

6. Fold Classification (SCOP + CATH) 12 domains

SCOP 2.08 (6 domains)

CATH v4.4 (6 domains)

7. Citations (1)