1ivs

CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS VALYL-TRNA SYNTHETASE COMPLEXED WITH TRNA(VAL) AND VALYL-ADENYLATE ANALOGUE

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Valyl-tRNA synthetase

Thermus thermophilus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	tRNA (Val) × 1 N-[VALINYL]-N'-[ADENOSYL]-DIAMINOSUFONE × 1 water × 2	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 1	tRNA (Val) × 1 N-[VALINYL]-N'-[ADENOSYL]-DIAMINOSUFONE × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYV_THETH
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–862； UniProt 1–862 Author chain B； PDBConstruct 1–862； UniProt 1–862

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1ivs
Deposition date deposition_date	2002-03-29
Structure title title	CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS VALYL-TRNA SYNTHETASE COMPLEXED WITH TRNA(VAL) AND VALYL-ADENYLATE ANALOGUE
Keywords keywords	;Rossmann fold, helix bundle, coiled coil, beta barrel, RIKEN Structural Genomics/Proteomics Initiative, RSGI, Structural Genomics, LIGASE-RNA COMPLEX ;; LIGASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1ivs__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1ivs__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1ivs__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	34.95 Å
Rg (electron density)	35.46 Å
Total Rg	35.71 Å
Atom count	8603
Residues	937
Excluded volume	147280 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1ivs__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`1ivs__assembly_2__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	tRNA (Val)
Molecular weight formula_weight	24174.5 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C,D
Atom count atom_count	17424

GGGCGGCUAGCUCAGCGGAAGAGCGCUCGCCUCACACGCGAGAGGUCGUAGGUUCAAGUCCUACGCCGCCCACCA

Entity 2 Entity 2 polymer

Description description	Valyl-tRNA synthetase
Molecular weight formula_weight	98914.4 kDa
EC 编号 ec_number	6.1.1.9
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

MDLPKAYDPKSVEPKWAEKWAKNPFVANPKSGKPPFVIFMPPPNVTGSLHMGHALDNSLQDALIRYKRMRGFEAVWLPGTDHAGIATQVVVERLLLKEGKTRHDLGREKFLERVWQWKEESGGTILKQLKRLGASADWSREAFTMDEKRSRAVRYAFSRYYHEGLAYRAPRLVNWCPRCETTLSDLEVETEPTPGKLYTLRYEVEGGGFIEIATVRPETVFADQAIAVHPEDERYRHLLGKRARIPLTEVWIPILADPAVEKDFGTGALKVTPAHDPLDYEIGERHGLKPVSVINLEGRMEGERVPEALRGLDRFEARRKAVELFREAGHLVKEEDYTIALATCSRCGTPIEYAIFPQWWLRMRPLAEEVLKGLRRGDIAFVPERWKKVNMDWLENVKDWNISRQLWWGHQIPAWYCEDCQAVNVPRPERYLEDPTSCEACGSPRLKRDEDVFDTWFSSALWPLSTLGWPEETEDLKAFYPGDVLVTGYDILFLWVSRMEVSGYHFMGERPFKTVLLHGLVLDEKGQKMSKSKGNVIDPLEMVERYGADALRFALIYLATGGQDIRLDLRWLEMARNFANKLYNAARFVLLSREGFQAKEDTPTLADRFMRSRLSRGVEEITALYEALDLAQAAREVYELVWSEFCDWYLEAAKPALKAGNAHTLRTLEEVLAVLLKLLHPMMPFLTSELYQALTGKEELALEAWPEPGGRDEEAERAFEALKQAVTAVRALKAEAGLPPAQEVRVYLEGETAPVEENLEVFRFLSRADLLPERPAKALVKAMPRVTARMPLEGLLDVEEWRRRQEKRLKELLALAERSQRKLASPGFREKAPKEVVEAEEARLKENLEQAERIREALSQIG

Source Source

Source organism organism	Thermus thermophilus
NCBI taxonomy ID ncbi_taxonomy_id	274
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 non-polymer

Description description	N-[VALINYL]-N'-[ADENOSYL]-DIAMINOSUFONE
Molecular weight formula_weight	444.5 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	218

▼

6. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (8 domains)

Domain ID domain_id	d1ivsa1
Class class	a — All alpha proteins
Fold Fold fold	a.2 — Long alpha-hairpin
Superfamily Superfamily superfamily	a.2.7 — tRNA-binding arm
Family Family family	a.2.7.3 — Valyl-tRNA synthetase (ValRS) C-terminal domain

Domain ID domain_id	d1ivsa2
Class class	a — All alpha proteins
Fold Fold fold	a.27 — Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases
Superfamily Superfamily superfamily	a.27.1 — Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases
Family Family family	a.27.1.1 — Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases

Domain ID domain_id	d1ivsa3
Class class	b — All beta proteins
Fold Fold fold	b.51 — ValRS/IleRS/LeuRS editing domain
Superfamily Superfamily superfamily	b.51.1 — ValRS/IleRS/LeuRS editing domain
Family Family family	b.51.1.1 — ValRS/IleRS/LeuRS editing domain

Domain ID domain_id	d1ivsa4
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.26 — Adenine nucleotide alpha hydrolase-like
Superfamily Superfamily superfamily	c.26.1 — Nucleotidylyl transferase
Family Family family	c.26.1.1 — Class I aminoacyl-tRNA synthetases (RS), catalytic domain

Domain ID domain_id	d1ivsb1
Class class	a — All alpha proteins
Fold Fold fold	a.2 — Long alpha-hairpin
Superfamily Superfamily superfamily	a.2.7 — tRNA-binding arm
Family Family family	a.2.7.3 — Valyl-tRNA synthetase (ValRS) C-terminal domain

Domain ID domain_id	d1ivsb2
Class class	a — All alpha proteins
Fold Fold fold	a.27 — Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases
Superfamily Superfamily superfamily	a.27.1 — Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases
Family Family family	a.27.1.1 — Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases

Domain ID domain_id	d1ivsb3
Class class	b — All beta proteins
Fold Fold fold	b.51 — ValRS/IleRS/LeuRS editing domain
Superfamily Superfamily superfamily	b.51.1 — ValRS/IleRS/LeuRS editing domain
Family Family family	b.51.1.1 — ValRS/IleRS/LeuRS editing domain

Domain ID domain_id	d1ivsb4
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.26 — Adenine nucleotide alpha hydrolase-like
Superfamily Superfamily superfamily	c.26.1 — Nucleotidylyl transferase
Family Family family	c.26.1.1 — Class I aminoacyl-tRNA synthetases (RS), catalytic domain

CATH v4.4 (10 domains)

Domain ID domain_id	1ivsA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	1ivsA02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	730 — Isoleucyl-tRNA Synthetase; Domain 1
Homologous superfamily homologous superfamily	10 — Isoleucyl-tRNA Synthetase; Domain 1

Domain ID domain_id	1ivsA03
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	740 — Isoleucyl-tRNA Synthetase; domain 2
Homologous superfamily homologous superfamily	10 — Valyl/Leucyl/Isoleucyl-tRNA synthetase, editing domain

Domain ID domain_id	1ivsA04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	1170 — Valyl-trna Synthetase; Chain: A, domain 4
Homologous superfamily homologous superfamily	10 —

Domain ID domain_id	1ivsA05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	287 — Helix Hairpins
Homologous superfamily homologous superfamily	380 — Valyl-tRNA synthetase, C-terminal domain

Domain ID domain_id	1ivsB01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	1ivsB02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	730 — Isoleucyl-tRNA Synthetase; Domain 1
Homologous superfamily homologous superfamily	10 — Isoleucyl-tRNA Synthetase; Domain 1

Domain ID domain_id	1ivsB03
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	740 — Isoleucyl-tRNA Synthetase; domain 2
Homologous superfamily homologous superfamily	10 — Valyl/Leucyl/Isoleucyl-tRNA synthetase, editing domain

Domain ID domain_id	1ivsB04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	1170 — Valyl-trna Synthetase; Chain: A, domain 4
Homologous superfamily homologous superfamily	10 —

Domain ID domain_id	1ivsB05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	287 — Helix Hairpins
Homologous superfamily homologous superfamily	380 — Valyl-tRNA synthetase, C-terminal domain

▶

Unit-cell length a length_a	411.810 Å
Unit-cell length b length_b	411.810 Å
Unit-cell length c length_c	81.970 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	P 42 21 2
Space-group number int_tables_number	94
Crystal system crystal_system	—

Resolution resolution	2.900 Å
Low-resolution limit resolution_low	40.000 Å
R factor r_factor	0.2480
R_work r_work	0.2480
R_free r_free	0.2820

CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS VALYL-TRNA SYNTHETASE COMPLEXED WITH TRNA(VAL) AND VALYL-ADENYLATE ANALOGUE

1. Protein Identity and Related Structures Protein Identity & Related Structures

Valyl-tRNA synthetase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1ivs__assembly_1__model_1

1ivs__assembly_1__model_1 | I(q)

1ivs__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (8 domains)

CATH v4.4 (10 domains)

7. Citations (2)

CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS VALYL-TRNA SYNTHETASE COMPLEXED WITH TRNA(VAL) AND VALYL-ADENYLATE ANALOGUE

1. Protein Identity and Related Structures Protein Identity & Related Structures

Valyl-tRNA synthetase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1ivs__assembly_1__model_1

1ivs__assembly_1__model_1 | I(q)

1ivs__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (8 domains)

CATH v4.4 (10 domains)

7. Citations (2)