SAXSdb — 1lwt

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

ENDONUCLEASE PI-SCEI

Saccharomyces cerevisiae

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Monomer Protein × 1 DNA 2 PDB declaration: trimeric（3） Consistent with all polymer counts	Chain A； UniProt 284–737	Non-standard monomer：Yes (specific site not provided by mmCIF)	PI-SceI DNA substrate top strand × 1 PI-SceI DNA substrate bottom strand × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 5.8；291 K；PEG 3550, na citrate, ammonium acetate, pH 5.8, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 3.20 Å R-free 0.287

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1LWT	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1DFA CRYSTAL STRUCTURE OF PI-SCEI IN C2 SPACE GROUP Deposited 1999-11-18	Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 284–737（454 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.3；323 K；20% PEG 3350, 100MM TRIS-HCL, 100MM KCL, 200MM MGCL2, pH 8.3, VAPOR DIFFUSION, HANGING DROP, temperature 323.0K	Resolution 2.00 Å R-free 0.280
1GPP Crystal structure of the S.cerevisiae Homing Endonuclease PI-SceI Domain I Deposited 2001-11-07	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 284–466（183 aa） Fragment：PROTEIN SPLICING DOMAIN, RESIDUES 284-466,693-736, SEE REMARK 999 Chain A 693–736（44 aa） Fragment：PROTEIN SPLICING DOMAIN, RESIDUES 284-466,693-736, SEE REMARK 999	Mutation：YES Mutation：YES	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 4.8；30 % PEG4000, 0.1 M SODIUM CITRATE PH 5.6, 0.2 M NH4-ACETATE	Resolution 1.35 Å R-free 0.189
1JVA CRYSTAL STRUCTURE OF THE VMA1-DERIVED ENDONUCLEASE BEARING THE N AND C EXTEIN PROPEPTIDES Deposited 2001-08-29	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 274–747（474 aa） Fragment：RESIDUES 274-747	Mutation：C284S/H362N/N737S/C738S	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.2；293 K；PEG6000, BisTrisHCl, mercaptoethanol, magnesium chloride, cadmium chloride, pH 6.2, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 2.10 Å R-free 0.240
1JVA CRYSTAL STRUCTURE OF THE VMA1-DERIVED ENDONUCLEASE BEARING THE N AND C EXTEIN PROPEPTIDES Deposited 2001-08-29	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 274–747（474 aa） Fragment：RESIDUES 274-747	Mutation：C284S/H362N/N737S/C738S	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.2；293 K；PEG6000, BisTrisHCl, mercaptoethanol, magnesium chloride, cadmium chloride, pH 6.2, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 2.10 Å R-free 0.240
1LWS Crystal structure of the intein homing endonuclease PI-SceI bound to its recognition sequence Deposited 2002-06-03	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 284–737（454 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	CA CALCIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；291 K；PEG 200, na hepes, calcium chloride, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 3.50 Å R-free 0.310
1UM2 Crystal Structure of the Vma1-Derived Endonuclease with the Ligated Extein Segment Deposited 2003-09-22	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 284–737（454 aa） Chain C 274–283（10 aa） Chain C 738–747（10 aa）	Mutation：C284S, H362N Mutation：C738S Mutation：C738S	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.2；293 K；PEG 6000, BistrisHCl, 2-mercaptoethanol, magnesium chloride, cadmium chloride, pH 6.2, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 2.90 Å R-free 0.283
1UM2 Crystal Structure of the Vma1-Derived Endonuclease with the Ligated Extein Segment Deposited 2003-09-22	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain B 284–737（454 aa） Chain D 274–283（10 aa） Chain D 738–747（10 aa）	Mutation：C284S, H362N Mutation：C738S Mutation：C738S	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.2；293 K；PEG 6000, BistrisHCl, 2-mercaptoethanol, magnesium chloride, cadmium chloride, pH 6.2, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 2.90 Å R-free 0.283
1VDE PI-SCEI, A HOMING ENDONUCLEASE WITH PROTEIN SPLICING ACTIVITY Deposited 1997-04-01	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 284–737（454 aa） Chain B 284–737（454 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.5；4% PEG 6K, 10MM BME, 3MM CDCL2, 1MM MGCL2, 100MM TRIS, PH=8.5	Resolution 2.40 Å R-free 0.238
3J9T Yeast V-ATPase state 1 Deposited 2015-02-23	Different construct Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 28 PDB declaration: 28-meric	Chain A 2–283（282 aa） Fragment：SEE REMARK 999 Chain A 738–1071（334 aa） Fragment：SEE REMARK 999 Chain C 2–283（282 aa） Fragment：SEE REMARK 999 Chain C 738–1071（334 aa） Fragment：SEE REMARK 999 Chain E 2–283（282 aa） Fragment：SEE REMARK 999 Chain E 738–1071（334 aa） Fragment：SEE REMARK 999	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer 50 mM Tris-HCl, 150 mM NaCl, 0.02% w/v dodecylmaltoside；pH 7.4；50 mM Tris-HCl, 150 mM NaCl, 0.02% w/v dodecylmaltoside cryo-EM vitrification conditions Blot for 23 seconds before freezing；77 K；Cryogen OTHER；Blot for 23 seconds before freezing in ethane/propane mixture (FEI VITROBOT MARK III).	Resolution 6.90 Å
3J9U Yeast V-ATPase state 2 Deposited 2015-02-23	Different construct Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 28 PDB declaration: 28-meric	Chain A 2–283（282 aa） Fragment：SEE REMARK 999 Chain A 738–1071（334 aa） Fragment：SEE REMARK 999 Chain C 2–283（282 aa） Fragment：SEE REMARK 999 Chain C 738–1071（334 aa） Fragment：SEE REMARK 999 Chain E 2–283（282 aa） Fragment：SEE REMARK 999 Chain E 738–1071（334 aa） Fragment：SEE REMARK 999	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer 50 mM Tris-HCl, 150 mM NaCl, 0.02% w/v dodecylmaltoside；pH 7.4；50 mM Tris-HCl, 150 mM NaCl, 0.02% w/v dodecylmaltoside cryo-EM vitrification conditions Blot for 23 seconds before freezing；77 K；Cryogen OTHER；Blot for 23 seconds before freezing in ethane/propane mixture (FEI VITROBOT MARK III).	Resolution 7.60 Å
3J9V Yeast V-ATPase state 3 Deposited 2015-02-23	Different construct Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 28 PDB declaration: 28-meric	Chain A 2–283（282 aa） Fragment：SEE REMARK 999 Chain A 738–1071（334 aa） Fragment：SEE REMARK 999 Chain C 2–283（282 aa） Fragment：SEE REMARK 999 Chain C 738–1071（334 aa） Fragment：SEE REMARK 999 Chain E 2–283（282 aa） Fragment：SEE REMARK 999 Chain E 738–1071（334 aa） Fragment：SEE REMARK 999	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer 50 mM Tris-HCl, 150 mM NaCl, 0.02% w/v dodecylmaltoside；pH 7.4；50 mM Tris-HCl, 150 mM NaCl, 0.02% w/v dodecylmaltoside cryo-EM vitrification conditions Blot for 23 seconds before freezing；77 K；Cryogen OTHER；Blot for 23 seconds before freezing in ethane/propane mixture (FEI VITROBOT MARK III).	Resolution 8.30 Å
5BW9 Crystal Structure of Yeast V1-ATPase in the Autoinhibited Form Deposited 2015-06-06	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 14 PDB declaration: tetradecameric	Chain A 1–283（283 aa） Chain A 738–1071（334 aa） Chain B 1–283（283 aa） Chain B 738–1071（334 aa） Chain C 1–283（283 aa） Chain C 738–1071（334 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions MICROFLUIDIC；pH 7.5；291 K；9.5 % PEG 8k, 150mM Ammonium Sulfate, 100mM HEPES, 12.5mM MgCl2	Resolution 7.00 Å R-free 0.309
5BW9 Crystal Structure of Yeast V1-ATPase in the Autoinhibited Form Deposited 2015-06-06	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 14 PDB declaration: tetradecameric	Chain a 1–283（283 aa） Chain a 738–1071（334 aa） Chain b 1–283（283 aa） Chain b 738–1071（334 aa） Chain c 1–283（283 aa） Chain c 738–1071（334 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions MICROFLUIDIC；pH 7.5；291 K；9.5 % PEG 8k, 150mM Ammonium Sulfate, 100mM HEPES, 12.5mM MgCl2	Resolution 7.00 Å R-free 0.309
5D80 Crystal Structure of Yeast V1-ATPase in the Autoinhibited Form Deposited 2015-08-14	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 15 PDB declaration: pentadecameric	Chain A 1–283（283 aa） Chain A 738–1071（334 aa） Chain B 1–283（283 aa） Chain B 738–1071（334 aa） Chain C 1–283（283 aa） Chain C 738–1071（334 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；291 K；8.25% PEG 8000, 0.25 M Ammonium Sulfate, 0.1 M HEPES pH 7.5, 0.05 M Strontium Chloride	Resolution 6.20 Å R-free 0.302
5D80 Crystal Structure of Yeast V1-ATPase in the Autoinhibited Form Deposited 2015-08-14	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 15 PDB declaration: pentadecameric	Chain a 1–283（283 aa） Chain a 738–1071（334 aa） Chain b 1–283（283 aa） Chain b 738–1071（334 aa） Chain c 1–283（283 aa） Chain c 738–1071（334 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；291 K；8.25% PEG 8000, 0.25 M Ammonium Sulfate, 0.1 M HEPES pH 7.5, 0.05 M Strontium Chloride	Resolution 6.20 Å R-free 0.302
5VOX Yeast V-ATPase in complex with Legionella pneumophila effector SidK (rotational state 1) Deposited 2017-05-03	Different construct Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 33 PDB declaration: 33-meric	Chain A 1–283（283 aa） Chain A 738–1071（334 aa） Chain C 1–283（283 aa） Chain C 738–1071（334 aa） Chain E 1–283（283 aa） Chain E 738–1071（334 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 6.80 Å
5VOY Yeast V-ATPase in complex with Legionella pneumophila effector SidK (rotational state 2) Deposited 2017-05-03	Different construct Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 33 PDB declaration: 33-meric	Chain A 1–283（283 aa） Chain A 738–1071（334 aa） Chain C 1–283（283 aa） Chain C 738–1071（334 aa） Chain E 1–283（283 aa） Chain E 738–1071（334 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 7.90 Å
5VOZ Yeast V-ATPase in complex with Legionella pneumophila effector SidK (rotational state 3) Deposited 2017-05-03	Different construct Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 33 PDB declaration: 33-meric	Chain A 1–283（283 aa） Chain A 738–1071（334 aa） Chain C 1–283（283 aa） Chain C 738–1071（334 aa） Chain E 1–283（283 aa） Chain E 738–1071（334 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 7.60 Å
9COP Yeast RAVE bound to V-ATPase V1 complex Deposited 2024-07-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 14 PDB declaration: 14-meric	Chain A 1–1071（1071 aa） Chain E 1–1071（1071 aa）	Not recorded	MG MAGNESIUM ION × 2 ADP ADENOSINE-5'-DIPHOSPHATE × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.70 Å

15 other PDB entries and 19 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	VATA_YEAST
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–454； UniProt 284–737

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1lwt
Deposition date deposition_date	2002-06-03
Structure title title	Crystal structure of the intein homing endonuclease PI-SceI bound to its substrate DNA (Ca2+ free)
Keywords keywords	HOMING ENDONUCLEASE, PROTEIN-DNA COMPLEX, INTEIN, ENDONUCLEASE, HYDROLASE-DNA COMPLEX; HYDROLASE/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	31.42 Å
Radius of gyration Rg (electron density) rg_electron	30.30 Å
Forward intensity I(0) i0	125671000.00
Molecular weight molecular_weight	73471.0 kDa
Excluded volume excluded_volume	85159 Å³
Envelope volume envelope_volume	113000 Å³
Hydration-shell volume shell_volume	32829 Å³
Envelope diameter envelope_diameter	119.8 Å
Shell Rg shell_rg	35.25 Å
Envelope Rg envelope_rg	30.56 Å
Shape Rg shape_rg	30.24 Å
Total Rg total_rg	30.84 Å
Total atoms total_atoms	5050
Residues n_residues	514
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	112.2 Å
Rg (real space) rg_real	31.69 Å
Rg uncertainty (real space) rg_real_error	1.45 Å
I(0) (real space) i0_real	1.2570e+08
I(0) uncertainty (real space) i0_real_error	2.3820e+06
Rg (reciprocal space) rg_reciprocal	31.58 Å
I(0) (reciprocal space) i0_reciprocal	125700000.0000
Solution quality estimate total_estimate	0.6182
Solution quality rating solution_quality	REASONABLE a REASONABLE solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	110.0 Å
Skewness Skewness skewness	0.578
Kurtosis Kurtosis kurtosis	0.015
Angular range angular_range	— – 0.2500 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	10480000.0000
Real-space data points n_real_points	51
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.741; Stabil: 1.000; Sysdev: 0.062; Positv: 1.000; Valcen: 0.869; Smooth: 0.755

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	PI-SceI DNA substrate top strand
Molecular weight formula_weight	11599.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B
Atom count atom_count	5065

CTCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGG

Entity 2 Entity 2 polymer

Description description	PI-SceI DNA substrate bottom strand
Molecular weight formula_weight	11172.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

GCCATTTCATTACCTCTTTCTCCGCACCCGACATAGA

Entity 3 Entity 3 polymer

Description description	ENDONUCLEASE PI-SCEI
Molecular weight formula_weight	51379.1 kDa
EC 编号 ec_number	3.1.-.-
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

CFAKGTNVLMADGSIECIENIEVGNKVMGKDGRPREVIKLPRGRETMYSVVQKSQHRAHKSDSSREVPELLKFTCNATHELVVRTPRSVRRLSRTIKGVEYFEVITFEMGQKKAPDGRIVELVKEVSKSYPISEGPERANELVESYRKASNKAYFEWTIEARDLSLLGSHVRKATYQTYAPILYENDHFFDYMQKSKFHLTIEGPKVLAYLLGLWIGDGLSDRATFSVDSRDTSLMERVTEYAEKLNLCAEYKDRKEPQVAKTVNLYSKVVRGNGIRNNLNTENPLWDAIVGLGFLKDGVKNIPSFLSTDNIGTRETFLAGLIDSDGYVTDEHGIKATIKTIHTSVRDGLVSLARSLGLVVSVNAEPAKVDMNGTKHKISYAIYMSGGDVLLNVLSKCAGSKKFRPAPAAAFARECRGFYFELQELKEDDYYGITLSDDSDHQFLLANQVVVHN

来源 Source

来源生物 organism	Saccharomyces cerevisiae
通用名 common_name	;baker's yeast ;
NCBI Class编号 ncbi_taxonomy_id	4932
宿主生物 host_organism	Escherichia coli

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	15

▼

7. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (3 domains)

Domain ID domain_id	d1lwta1
Class class	b — All beta proteins
Fold Fold fold	b.86 — Hedgehog/intein (Hint) domain
Superfamily Superfamily superfamily	b.86.1 — Hedgehog/intein (Hint) domain
Family Family family	b.86.1.2 — Intein (protein splicing domain)

Domain ID domain_id	d1lwta2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.95 — Homing endonuclease-like
Superfamily Superfamily superfamily	d.95.2 — Homing endonucleases
Family Family family	d.95.2.2 — Intein endonuclease

Domain ID domain_id	d1lwta3
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.95 — Homing endonuclease-like
Superfamily Superfamily superfamily	d.95.2 — Homing endonucleases
Family Family family	d.95.2.2 — Intein endonuclease

CATH v4.4 (3 domains)

Domain ID domain_id	1lwtA01
Class class	2 — Mainly Beta
Architecture architecture	170 — Beta Complex
Topology topology	16 — Endonuclease - Pi-scei; Chain A, domain 1
Homologous superfamily homologous superfamily	10 — Hedgehog/Intein (Hint) domain

Domain ID domain_id	1lwtA02
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	28 — Endonuclease I-creI
Homologous superfamily homologous superfamily	10 — Homing endonucleases

Domain ID domain_id	1lwtA03
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	28 — Endonuclease I-creI
Homologous superfamily homologous superfamily	10 — Homing endonucleases

▶

8. Citations (2)

▶

Unit-cell length a length_a	45.200 Å
Unit-cell length b length_b	87.400 Å
Unit-cell length c length_c	214.800 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	3.200 Å
Low-resolution limit resolution_low	24.490 Å
R factor r_factor	—
R_work r_work	0.2420
R_free r_free	0.2870

fit	/app/data/saxs_computation/lw/1lwt/1lwt.fit
pddf	/app/data/pr_computation/lw/1lwt/1lwt.pr.out
profile	/app/data/saxs_computation/lw/1lwt/1lwt.dat

Crystal structure of the intein homing endonuclease PI-SceI bound to its substrate DNA (Ca2+ free)

1. Protein Identity and Related Structures Protein Identity & Related Structures

ENDONUCLEASE PI-SCEI

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

来源 Source

Entity 4 Entity 4 water

7. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (3 domains)

CATH v4.4 (3 domains)

8. Citations (2)

9. Files and Curves (10)

Files (7)

Curves (3)