1nne

Crystal Structure of the MutS-ADPBeF3-DNA complex

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA Mismatch Repair protein MutS

OrganismNot specified

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 2 DNA 2	5'-D(GPCPGPAPCPGPCPTPAPGPCPGPTPGPCPGPGPCPTPCPGPTPC)-3' × 1 5'-D(PGPGPAPCPGPAPGPCPCPGPCPCPGPCPTPAPGPCPGPTPCP*G)-3' × 1 SULFATE ION × 2 BERYLLIUM TRIFLUORIDE ION × 2 ADENOSINE-5'-DIPHOSPHATE × 2 1,2-ETHANEDIOL × 1 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MUTS_THEAQ
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–765； UniProt 1–765 Author chain B； PDBConstruct 1–765； UniProt 1–765

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1nne
Deposition date deposition_date	2003-01-13
Structure title title	Crystal Structure of the MutS-ADPBeF3-DNA complex
Keywords keywords	DNA, DNA BINDING PROTEIN-DNA COMPLEX; DNA BINDING PROTEIN/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1nne__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1nne__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1nne__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	41.07 Å
Rg (electron density)	40.19 Å
Total Rg	40.60 Å
Atom count	12990
Residues	1563
Excluded volume	228610 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1nne__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Description description	5'-D(GPCPGPAPCPGPCPTPAPGPCPGPTPGPCPGPGPCPTPCPGPTP*C)-3'
Molecular weight formula_weight	7074.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C
Atom count atom_count	13089

GCGACGCTAGCGTGCGGCTCGTC

Entity 2 Entity 2 polymer

Description description	5'-D(PGPGPAPCPGPAPGPCPCPGPCPCPGPCPTPAPGPCPGPTPCPG)-3'
Molecular weight formula_weight	6779.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

GGACGAGCCGCCGCTAGCGTCG

Entity 3 Entity 3 polymer

Description description	DNA Mismatch Repair protein MutS
Molecular weight formula_weight	85776.5 kDa
Source method src_method	nat
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

MEGMLKGEGPGPLPPLLQQYVELRDQYPDYLLLFQVGDFYECFGEDAERLARALGLVLTHKTSKDFTTPMAGIPLRAFEAYAERLLKMGFRLAVADQVEPAEEAEGLVRREVTQLLTPGTLLQESLLPREANYLAAIATGDGWGLAFLDVSTGEFKGTVLKSKSALYDELFRHRPAEVLLAPELLENGAFLDEFRKRFPVMLSEAPFEPEGEGPLALRRARGALLAYAQRTQGGALSLQPFRFYDPGAFMRLPEATLRALEVFEPLRGQDTLFSVLDETRTAPGRRLLQSWLRHPLLDRGPLEARLDRVEGFVREGALREGVRRLLYRLADLERLATRLELGRASPKDLGALRRSLQILPELRALLGEEVGLPDLSPLKEELEAALVEDPPLKVSEGGLIREGYDPDLDALRAAHREGVAYFLELEERERERTGIPTLKVGYNAVFGYYLEVTRPYYERVPKEYRPVQTLKDRQRYTLPEMKEKEREVYRLEALIRRREEEVFLEVRERAKRQAEALREAARILAELDVYAALAEVAVRYGYVRPRFGDRLQIRAGRHPVVERRTEFVPNDLEMAHELVLITGPNMAGKSTFLRQTALIALLAQVGSFVPAEEAHLPLFDGIYTRIGASDDLAGGKSTFMVEMEEVALILKEATENSLVLLDEVGRGTSSLDGVAIATAVAEALHERRAYTLFATHYFELTALGLPRLKNLHVAAREEAGGLVFYHQVLPGPASKSYGVEVAAMAGLPKEVVARARALLQAMAAR

Entity 4 Entity 4 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 non-polymer

Description description	BERYLLIUM TRIFLUORIDE ION
Molecular weight formula_weight	66.0 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 6 Entity 6 non-polymer

Description description	ADENOSINE-5'-DIPHOSPHATE
Molecular weight formula_weight	427.2 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 7 Entity 7 non-polymer

Description description	1,2-ETHANEDIOL
Molecular weight formula_weight	62.1 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 8 Entity 8 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	99

▼

6. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (8 domains)

Domain ID domain_id	d1nnea1
Class class	a — All alpha proteins
Fold Fold fold	a.113 — DNA repair protein MutS, domain III
Superfamily Superfamily superfamily	a.113.1 — DNA repair protein MutS, domain III
Family Family family	a.113.1.1 — DNA repair protein MutS, domain III

Domain ID domain_id	d1nnea2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.12 — ABC transporter ATPase domain-like

Domain ID domain_id	d1nnea3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.55 — Ribonuclease H-like motif
Superfamily Superfamily superfamily	c.55.6 — DNA repair protein MutS, domain II
Family Family family	c.55.6.1 — DNA repair protein MutS, domain II

Domain ID domain_id	d1nnea4
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.75 — MutS N-terminal domain-like
Superfamily Superfamily superfamily	d.75.2 — DNA repair protein MutS, domain I
Family Family family	d.75.2.1 — DNA repair protein MutS, domain I

Domain ID domain_id	d1nneb1
Class class	a — All alpha proteins
Fold Fold fold	a.113 — DNA repair protein MutS, domain III
Superfamily Superfamily superfamily	a.113.1 — DNA repair protein MutS, domain III
Family Family family	a.113.1.1 — DNA repair protein MutS, domain III

Domain ID domain_id	d1nneb2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.12 — ABC transporter ATPase domain-like

Domain ID domain_id	d1nneb3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.55 — Ribonuclease H-like motif
Superfamily Superfamily superfamily	c.55.6 — DNA repair protein MutS, domain II
Family Family family	c.55.6.1 — DNA repair protein MutS, domain II

Domain ID domain_id	d1nneb4
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.75 — MutS N-terminal domain-like
Superfamily Superfamily superfamily	d.75.2 — DNA repair protein MutS, domain I
Family Family family	d.75.2.1 — DNA repair protein MutS, domain I

CATH v4.4 (10 domains)

Domain ID domain_id	1nneA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	1170 — MutS, DNA mismatch repair protein, domain I
Homologous superfamily homologous superfamily	10 — DNA repair protein MutS, domain I

Domain ID domain_id	1nneA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	110 — MutS, connector domain

Domain ID domain_id	1nneA03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1420 — MutS, DNA mismatch repair protein; Chain A, domain 3
Homologous superfamily homologous superfamily	10 —

Domain ID domain_id	1nneA04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1420 — MutS, DNA mismatch repair protein; Chain A, domain 3
Homologous superfamily homologous superfamily	10 —

Domain ID domain_id	1nneA05
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1nneB01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	1170 — MutS, DNA mismatch repair protein, domain I
Homologous superfamily homologous superfamily	10 — DNA repair protein MutS, domain I

Domain ID domain_id	1nneB02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	110 — MutS, connector domain

Domain ID domain_id	1nneB03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1420 — MutS, DNA mismatch repair protein; Chain A, domain 3
Homologous superfamily homologous superfamily	10 —

Domain ID domain_id	1nneB04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1420 — MutS, DNA mismatch repair protein; Chain A, domain 3
Homologous superfamily homologous superfamily	10 —

Domain ID domain_id	1nneB05
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

▶

Unit-cell length a length_a	103.442 Å
Unit-cell length b length_b	113.224 Å
Unit-cell length c length_c	160.284 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	3.110 Å
Low-resolution limit resolution_low	19.940 Å
R factor r_factor	0.2090
R_work r_work	0.2090
R_free r_free	0.2590

Crystal Structure of the MutS-ADPBeF3-DNA complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA Mismatch Repair protein MutS

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1nne__assembly_1__model_1

1nne__assembly_1__model_1 | I(q)

1nne__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 water

6. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (8 domains)

CATH v4.4 (10 domains)

7. Citations (1)

Crystal Structure of the MutS-ADPBeF3-DNA complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA Mismatch Repair protein MutS

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1nne__assembly_1__model_1

1nne__assembly_1__model_1 | I(q)

1nne__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 water

6. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (8 domains)

CATH v4.4 (10 domains)

7. Citations (1)