SAXSdb — 1u63

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

50S ribosomal protein L1P

Methanocaldococcus jannaschii

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Monomer Protein × 1 RNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain A； UniProt 1–219	Non-standard monomer：Yes (specific site not provided by mmCIF)	49 NT FRAGMENT OF MRNA FOR L1 × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 6；295 K；PEG 10000, MPD, KCL, NACl, pH 6.0, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 3.40 Å R-free 0.302
2	Protein–RNA Monomer Protein × 1 RNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain C； UniProt 1–219	Non-standard monomer：Yes (specific site not provided by mmCIF)	49 NT FRAGMENT OF MRNA FOR L1 × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 6；295 K；PEG 10000, MPD, KCL, NACl, pH 6.0, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 3.40 Å R-free 0.302

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1U63	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1CJS CRYSTAL STRUCTURE OF RIBOSOMAL PROTEIN L1 FROM METHANOCOCCUS JANNASCHII Deposited 1999-04-19	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 14–232（219 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 7.5；pH 7.50, VAPOR DIFFUSION	Resolution 2.30 Å R-free 0.271
1I2A CRYSTAL STRUCTURE OF L1 RIBOSOMAL PROTEIN FROM METHANOCOCCUS JANNASCHII WITH 1.85A RESOLUTION. Deposited 2001-02-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 14–232（219 aa）	Not recorded	PTL PENTANAL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；301.5 K；PEG 10000, HEPES-HCl, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 301.5K	Resolution 1.85 Å R-free 0.247
4LQ4 crystal structure of mutant ribosomal protein L1 from Methanococcus jannaschii with deletion of 8 residues from C-terminus Deposited 2013-07-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–211（211 aa）	Not recorded	TLA L(+)-TARTARIC ACID × 1 IPA ISOPROPYL ALCOHOL × 1 CL CHLORIDE ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；277 K；20% PEG4000, 10% isopropanol, 0.1 M Hepes-NaOH, 0.5 mkl 0.8 KNa-tartrate, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 1.75 Å R-free 0.220

3 other PDB entries and 3 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	RL1_METJA
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–219； UniProt 1–219 Author chain C； PDBConstruct 1–219； UniProt 1–219

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1u63
Deposition date deposition_date	2004-07-29
Structure title title	THE STRUCTURE OF A RIBOSOMAL PROTEIN L1-mRNA COMPLEX
Keywords keywords	RIBOSOME, RIBOSOMAL PROTEIN, MRNA-PROTEIN COMPLEX, TRANSCRIPTION-RNA COMPLEX; TRANSCRIPTION/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	28.61 Å
Radius of gyration Rg (electron density) rg_electron	28.46 Å
Forward intensity I(0) i0	169523000.00
Molecular weight molecular_weight	80945.0 kDa
Excluded volume excluded_volume	91742 Å³
Envelope volume envelope_volume	129990 Å³
Hydration-shell volume shell_volume	38016 Å³
Envelope diameter envelope_diameter	99.4 Å
Shell Rg shell_rg	35.84 Å
Envelope Rg envelope_rg	28.30 Å
Shape Rg shape_rg	28.46 Å
Total Rg total_rg	29.02 Å
Total atoms total_atoms	5510
Residues n_residues	514
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	93.0 Å
Rg (real space) rg_real	28.53 Å
Rg uncertainty (real space) rg_real_error	0.61 Å
I(0) (real space) i0_real	1.6950e+08
I(0) uncertainty (real space) i0_real_error	2.2380e+06
Rg (reciprocal space) rg_reciprocal	28.57 Å
I(0) (reciprocal space) i0_reciprocal	169500000.0000
Solution quality estimate total_estimate	0.8890
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	35.5 Å
Skewness Skewness skewness	0.277
Kurtosis Kurtosis kurtosis	-0.237
Angular range angular_range	— – 0.2750 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	11590000.0000
Real-space data points n_real_points	56
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.860; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 1.000; Smooth: 0.972

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Description description	49 NT FRAGMENT OF MRNA FOR L1
Molecular weight formula_weight	15867.5 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B,D
Atom count atom_count	5510

GGGAGUGAAGGAGGCUCGCGAACUCGCGAAGCCGAGAAACUUCACUCCC

Entity 2 Entity 2 polymer

Description description	50S ribosomal protein L1P
Molecular weight formula_weight	25123.9 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,C

MDREALLQAVKEARELAKPRNFTQSFEFIATLKEIDMRKPENRIKTEVVLPHGRGKEAKIAVIGTGDLAKQAEELGLTVIRKEEIEELGKNKRKLRKIAKAHDFFIAQADLMPLIGRYMGVILGPRGKMPKPVPANANIKPLVERLKKTVVINTRDKPYFQVLVGNEKMTDEQIVDNIEAVLNVVAKKYEKGLYHIKDAYVKLTMGPAVKVKKEKAKKK

来源 Source

来源生物 organism	Methanocaldococcus jannaschii
NCBI Class编号 ncbi_taxonomy_id	2190
宿主生物 host_organism	Escherichia coli

▼

7. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (2 domains)

Domain ID domain_id	d1u63a1
Class class	e — Multi-domain proteins (alpha and beta)
Fold Fold fold	e.24 — Ribosomal protein L1
Superfamily Superfamily superfamily	e.24.1 — Ribosomal protein L1
Family Family family	e.24.1.1 — Ribosomal protein L1

Domain ID domain_id	d1u63c1
Class class	e — Multi-domain proteins (alpha and beta)
Fold Fold fold	e.24 — Ribosomal protein L1
Superfamily Superfamily superfamily	e.24.1 — Ribosomal protein L1
Family Family family	e.24.1.1 — Ribosomal protein L1

CATH v4.4 (4 domains)

Domain ID domain_id	1u63A01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	190 — Ribulose 1,5 Bisphosphate Carboxylase/Oxygenase
Homologous superfamily homologous superfamily	20 — Ribosomal protein L1/L10, rRNA-binding domain

Domain ID domain_id	1u63A02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	790 — Ribosomal protein L1/L10, domain II

Domain ID domain_id	1u63C01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	190 — Ribulose 1,5 Bisphosphate Carboxylase/Oxygenase
Homologous superfamily homologous superfamily	20 — Ribosomal protein L1/L10, rRNA-binding domain

Domain ID domain_id	1u63C02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	790 — Ribosomal protein L1/L10, domain II

▶

8. Citations (1)

▶

Unit-cell length a length_a	212.290 Å
Unit-cell length b length_b	68.900 Å
Unit-cell length c length_c	115.870 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	122.99 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	3.400 Å
Low-resolution limit resolution_low	8.000 Å
R factor r_factor	0.2760
R_work r_work	0.2760
R_free r_free	0.3020

fit	/app/data/saxs_computation/u6/1u63/1u63.fit
pddf	/app/data/pr_computation/u6/1u63/1u63.pr.out
profile	/app/data/saxs_computation/u6/1u63/1u63.dat

THE STRUCTURE OF A RIBOSOMAL PROTEIN L1-mRNA COMPLEX

1. Protein Identity and Related Structures Protein Identity & Related Structures

50S ribosomal protein L1P

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

7. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (2 domains)

CATH v4.4 (4 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)