1w36

RecBCD:DNA complex

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

EXODEOXYRIBONUCLEASE V BETA CHAIN

ESCHERICHIA COLI

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 1	EXODEOXYRIBONUCLEASE V GAMMA CHAIN × 1 （P07648） EXODEOXYRIBONUCLEASE V ALPHA CHAIN × 1 （P04993） DNA HAIRPIN × 1 CALCIUM ION × 1	Consistent with all polymers
2	Protein–DNA	Heteromer	Protein 3 DNA 1	EXODEOXYRIBONUCLEASE V GAMMA CHAIN × 1 （P07648） EXODEOXYRIBONUCLEASE V ALPHA CHAIN × 1 （P04993） DNA HAIRPIN × 1 CALCIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	EX5B_ECOLI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain B； PDBConstruct 1–1180； UniProt 1–1180 Author chain E； PDBConstruct 1–1180； UniProt 1–1180

EXODEOXYRIBONUCLEASE V GAMMA CHAIN

ESCHERICHIA COLI

UniProt P07648

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 1	EXODEOXYRIBONUCLEASE V BETA CHAIN × 1 （P08394） EXODEOXYRIBONUCLEASE V ALPHA CHAIN × 1 （P04993） DNA HAIRPIN × 1 CALCIUM ION × 1	Consistent with all polymers
2	Protein–DNA	Heteromer	Protein 3 DNA 1	EXODEOXYRIBONUCLEASE V BETA CHAIN × 1 （P08394） EXODEOXYRIBONUCLEASE V ALPHA CHAIN × 1 （P04993） DNA HAIRPIN × 1 CALCIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	EX5C_ECOLI
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain C； PDBConstruct 1–1122； UniProt 1–1122 Author chain F； PDBConstruct 1–1122； UniProt 1–1122

EXODEOXYRIBONUCLEASE V ALPHA CHAIN

ESCHERICHIA COLI

UniProt P04993

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 1	EXODEOXYRIBONUCLEASE V BETA CHAIN × 1 （P08394） EXODEOXYRIBONUCLEASE V GAMMA CHAIN × 1 （P07648） DNA HAIRPIN × 1 CALCIUM ION × 1	Consistent with all polymers
2	Protein–DNA	Heteromer	Protein 3 DNA 1	EXODEOXYRIBONUCLEASE V BETA CHAIN × 1 （P08394） EXODEOXYRIBONUCLEASE V GAMMA CHAIN × 1 （P07648） DNA HAIRPIN × 1 CALCIUM ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	EX5A_ECOLI
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain D； PDBConstruct 1–608； UniProt 1–608 Author chain G； PDBConstruct 1–608； UniProt 1–608

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1w36
Deposition date deposition_date	2004-07-13
Structure title title	RecBCD:DNA complex
Keywords keywords	RECOMBINATION, HELICASE, NUCLEASE, HYDROLASE, DNA REPAIR; RECOMBINATION
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1w36__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1w36__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1w36__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	47.52 Å
Rg (electron density)	46.75 Å
Total Rg	47.02 Å
Atom count	23255
Residues	2857
Excluded volume	409750 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1w36__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`1w36__assembly_2__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	EXODEOXYRIBONUCLEASE V BETA CHAIN
Molecular weight formula_weight	134110.6 kDa
EC 编号 ec_number	3.1.11.5
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B,E
Atom count atom_count	46145

MSDVAETLDPLRLPLQGERLIEASAGTGKTFTIAALYLRLLLGLGGSAAFPRPLTVEELLVVTFTEAATAELRGRIRSNIHELRIACLRETTDNPLYERLLEEIDDKAQAAQWLLLAERQMDEAAVFTIHGFCQRMLNLNAFESGMLFEQQLIEDESLLRYQACADFWRRHCYPLPREIAQVVFETWKGPQALLRDINRYLQGEAPVIKAPPPDDETLASRHAQIVARIDTVKQQWRDAVGELDALIESSGIDRRKFNRSNQAKWIDKISAWAEEETNSYQLPESLEKFSQRFLEDRTKAGGETPRHPLFEAIDQLLAEPLSIRDLVITRALAEIRETVAREKRRRGELGFDDMLSRLDSALRSESGEVLAAAIRTRFPVAMIDEFQDTDPQQYRIFRRIWHHQPETALLLIGDPKQAIYAFRGADIFTYMKARSEVHAHYTLDTNWRSAPGMVNSVNKLFSQTDDAFMFREIPFIPVKSAGKNQALRFVFKGETQPAMKMWLMEGESCGVGDYQSTMAQVCAAQIRDWLQAGQRGEALLMNGDDARPVRASDISVLVRSRQEAAQVRDALTLLEIPSVYLSNRDSVFETLEAQEMLWLLQAVMTPERENTLRSALATSMMGLNALDIETLNNDEHAWDVVVEEFDGYRQIWRKRGVMPMLRALMSARNIAENLLATAGGERRLTDILHISELLQEAGTQLESEHALVRWLSQHILEPDSNASSQQMRLESDKHLVQIVTIHKSKGLEYPLVWLPFITNFRVQEQAFYHDRHSFEAVLDLNAAPESVDLAEAERLAEDLRLLYVALTRSVWHCSLGVAPLVRRRGDKKGDTDVHQSALGRLLQKGEPQDAAGLRTCIEALCDDDIAWQTAQTGDNQPWQVNDVSTAELNAKTLQRLPGDNWRVTSYSGLQQRGHGIAQDLMPRLDVDAAGVASVVEEPTLTPHQFPRGASPGTFLHSLFEDLDFTQPVDPNWVREKLELGGFESQWEPVLTEWITAVLQAPLNETGVSLSQLSARNKQVEMEFYLPISEPLIASQLDTLIRQFDPLSAGCPPLEFMQVRGMLKGFIDLVFRHEGRYYLLDYKSNWLGEDSSAYTQQAMAAAMQAHRYDLQYQLYTLALHRYLRHRIADYDYEHHFGGVIYLFLRGVDKEHPQQGIYTTRPNAGLIALMDEMFAGMTLEEA

Source Source

Source organism organism	ESCHERICHIA COLI
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	ESCHERICHIA COLI

Entity 2 Entity 2 polymer

Description description	EXODEOXYRIBONUCLEASE V GAMMA CHAIN
Molecular weight formula_weight	128974.1 kDa
EC 编号 ec_number	3.1.11.5
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C,F

MLRVYHSNRLDVLEALMEFIVERERLDDPFEPEMILVQSTGMAQWLQMTLSQKFGIAANIDFPLPASFIWDMFVRVLPEIPKESAFNKQSMSWKLMTLLPQLLEREDFTLLRHYLTDDSDKRKLFQLSSKAADLFDQYLVYRPDWLAQWETGHLVEGLGEAQAWQAPLWKALVEYTHQLGQPRWHRANLYQRFIETLESATTCPPGLPSRVFICGISALPPVYLQALQALGKHIEIHLLFTNPCRYYWGDIKDPAYLAKLLTRQRRHSFEDRELPLFRDSENAGQLFNSDGEQDVGNPLLASWGKLGRDYIYLLSDLESSQELDAFVDVTPDNLLHNIQSDILELENRAVAGVNIEEFSRSDNKRPLDPLDSSITFHVCHSPQREVEVLHDRLLAMLEEDPTLTPRDIIVMVADIDSYSPFIQAVFGSAPADRYLPYAISDRRARQSHPVLEAFISLLSLPDSRFVSEDVLALLDVPVLAARFDITEEGLRYLRQWVNESGIRWGIDDDNVRELELPATGQHTWRFGLTRMLLGYAMESAQGEWQSVLPYDESSGLIAELVGHLASLLMQLNIWRRGLAQERPLEEWLPVCRDMLNAFFLPDAETEAAMTLIEQQWQAIIAEGLGAQYGDAVPLSLLRDELAQRLDQERISQRFLAGPVNICTLMPMRSIPFKVVCLLGMNDGVYPRQLAPLGFDLMSQKPKRGDRSRRDDDRYLFLEALISAQQKLYISYIGRSIQDNSERFPSVLVQELIDYIGQSHYLPGDEALNCDESEARVKAHLTCLHTRMPFDPQNYQPGERQSYAREWLPAASQAGKAHSEFVQPLPFTLPETVPLETLQRFWAHPVRAFFQMRLQVNFRTEDSEIPDTEPFILEGLSRYQINQQLLNALVEQDDAERLFRRFRAAGDLPYGAFGEIFWETQCQEMQQLADRVIACRQPGQSMEIDLACNGVQITGWLPQVQPDGLLRWRPSLLSVAQGMQLWLEHLVYCASGGNGESRLFLRKDGEWRFPPLAAEQALHYLSQLIEGYREGMSAPLLVLPESGGAWLKTCYDAQNDAMLDDDSTLQKARTKFLQAYEGNMMVRGEGDDIWYQRLWRQLTPETMEAIVEQSQRFLLPLFRFNQS

Source Source

Source organism organism	ESCHERICHIA COLI
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	ESCHERICHIA COLI

Entity 3 Entity 3 polymer

Description description	EXODEOXYRIBONUCLEASE V ALPHA CHAIN
Molecular weight formula_weight	66990.4 kDa
EC 编号 ec_number	3.1.11.5
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	D,G

MKLQKQLLEAVEHKQLRPLDVQFALTVAGDEHPAVTLAAALLSHDAGEGHVCLPLSRLENNEASHPLLATCVSEIGELQNWEECLLASQAVSRGDEPTPMILCGDRLYLNRMWCNERTVARFFNEVNHAIEVDEALLAQTLDKLFPVSDEINWQKVAAAVALTRRISVISGGPGTGKTTTVAKLLAALIQMADGERCRIRLAAPTGKAAARLTESLGKALRQLPLTDEQKKRIPEDASTLHRLLGAQPGSQRLRHHAGNPLHLDVLVVDEASMIDLPMMSRLIDALPDHARVIFLGDRDQLASVEAGAVLGDICAYANAGFTAERARQLSRLTGTHVPAGTGTEAASLRDSLCLLQKSYRFGSDSGIGQLAAAINRGDKTAVKTVFQQDFTDIEKRLLQSGEDYIAMLEEALAGYGRYLDLLQARAEPDLIIQAFNEYQLLCALREGPFGVAGLNERIEQFMQQKRKIHRHPHSRWYEGRPVMIARNDSALGLFNGDIGIALDRGQGTRVWFAMPDGNIKSVQPSRLPEHETTWAMTVHKSQGSEFDHAALILPSQRTPVVTRELVYTAVTRARRRLSLYADERILSAAIATRTERRSGLAALFSSRE

Source Source

Source organism organism	ESCHERICHIA COLI
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	ESCHERICHIA COLI

Entity 4 Entity 4 polymer

Description description	DNA HAIRPIN
Molecular weight formula_weight	13170.5 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	Y,Z

TCTAATGCGAGCACTGCTATTCCCTAGCAGTGCTCGCATTAGA

Entity 5 Entity 5 non-polymer

Description description	CALCIUM ION
Molecular weight formula_weight	40.1 kDa
Source method src_method	syn
Copy count entity_count	2

▼

6. Fold Classification (SCOP + CATH) 42 domains

SCOP 2.08 (16 domains)

Domain ID domain_id	d1w36b1
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

Domain ID domain_id	d1w36b2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

Domain ID domain_id	d1w36b3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.52 — Restriction endonuclease-like
Superfamily Superfamily superfamily	c.52.1 — Restriction endonuclease-like
Family Family family	c.52.1.24 — Exodeoxyribonuclease V beta chain (RecB), C-terminal domain

Domain ID domain_id	d1w36c1
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

Domain ID domain_id	d1w36c2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

Domain ID domain_id	d1w36c3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.52 — Restriction endonuclease-like
Superfamily Superfamily superfamily	c.52.1 — Restriction endonuclease-like
Family Family family	c.52.1.25 — Exodeoxyribonuclease V beta chain (RecC), C-terminal domain

Domain ID domain_id	d1w36d1
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

Domain ID domain_id	d1w36d2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

Domain ID domain_id	d1w36e1
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

Domain ID domain_id	d1w36e2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

Domain ID domain_id	d1w36e3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.52 — Restriction endonuclease-like
Superfamily Superfamily superfamily	c.52.1 — Restriction endonuclease-like
Family Family family	c.52.1.24 — Exodeoxyribonuclease V beta chain (RecB), C-terminal domain

Domain ID domain_id	d1w36f1
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

Domain ID domain_id	d1w36f2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

Domain ID domain_id	d1w36f3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.52 — Restriction endonuclease-like
Superfamily Superfamily superfamily	c.52.1 — Restriction endonuclease-like
Family Family family	c.52.1.25 — Exodeoxyribonuclease V beta chain (RecC), C-terminal domain

Domain ID domain_id	d1w36g1
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

Domain ID domain_id	d1w36g2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.19 — Tandem AAA-ATPase domain

CATH v4.4 (26 domains)

Domain ID domain_id	1w36B01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1w36B02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	3170 — Recbcd, chain B, domain 2
Homologous superfamily homologous superfamily	10 — Recbcd, chain B, domain 2

Domain ID domain_id	1w36B03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1w36B04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	486 — PCRA; domain 4
Homologous superfamily homologous superfamily	10 — PCRA; domain 4

Domain ID domain_id	1w36B05
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	320 — Lambda Exonuclease; Chain A
Homologous superfamily homologous superfamily	10 —

Domain ID domain_id	1w36C01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	10930 —

Domain ID domain_id	1w36C02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	160 —

Domain ID domain_id	1w36C03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1w36C04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	486 — PCRA; domain 4
Homologous superfamily homologous superfamily	10 — PCRA; domain 4

Domain ID domain_id	1w36C06
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	990 —

Domain ID domain_id	1w36D01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	1020 — RecBCD complex, subunit RecD, N-terminal domain

Domain ID domain_id	1w36D02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1w36D03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1w36E01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1w36E02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	3170 — Recbcd, chain B, domain 2
Homologous superfamily homologous superfamily	10 — Recbcd, chain B, domain 2

Domain ID domain_id	1w36E03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1w36E04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	486 — PCRA; domain 4
Homologous superfamily homologous superfamily	10 — PCRA; domain 4

Domain ID domain_id	1w36E05
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	320 — Lambda Exonuclease; Chain A
Homologous superfamily homologous superfamily	10 —

Domain ID domain_id	1w36F01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	10930 —

Domain ID domain_id	1w36F02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	160 —

Domain ID domain_id	1w36F03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1w36F04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	486 — PCRA; domain 4
Homologous superfamily homologous superfamily	10 — PCRA; domain 4

Domain ID domain_id	1w36F06
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	990 —

Domain ID domain_id	1w36G01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	1020 — RecBCD complex, subunit RecD, N-terminal domain

Domain ID domain_id	1w36G02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1w36G03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

▶

Unit-cell length a length_a	132.602 Å
Unit-cell length b length_b	187.234 Å
Unit-cell length c length_c	335.369 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	3.100 Å
Low-resolution limit resolution_low	46.840 Å
R factor r_factor	0.2420
R_work r_work	0.2420
R_free r_free	0.2960

RecBCD:DNA complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

EXODEOXYRIBONUCLEASE V BETA CHAIN

State in the Current Structure

Other States of the Same Protein in the Database

EXODEOXYRIBONUCLEASE V GAMMA CHAIN

State in the Current Structure

Other States of the Same Protein in the Database

EXODEOXYRIBONUCLEASE V ALPHA CHAIN

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1w36__assembly_1__model_1

1w36__assembly_1__model_1 | I(q)

1w36__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

6. Fold Classification (SCOP + CATH) 42 domains

SCOP 2.08 (16 domains)

CATH v4.4 (26 domains)

7. Citations (1)

RecBCD:DNA complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

EXODEOXYRIBONUCLEASE V BETA CHAIN

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

EXODEOXYRIBONUCLEASE V GAMMA CHAIN

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

EXODEOXYRIBONUCLEASE V ALPHA CHAIN

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1w36__assembly_1__model_1

1w36__assembly_1__model_1 | I(q)

1w36__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

6. Fold Classification (SCOP + CATH) 42 domains

SCOP 2.08 (16 domains)

CATH v4.4 (26 domains)

7. Citations (1)