1w7a

ATP bound MutS

Method: X-RAY DIFFRACTION D_max: 130.1 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA MISMATCH REPAIR PROTEIN MUTS

ESCHERICHIA COLI

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 2 DNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 1–800 Chain B； UniProt 1–800	Fragment：RESIDUES 1-800	;5'-D(APGPCPTPGPCPCPAPGPGP CPAPCPCPAPGPTPGPTPCPAPGPCPGPTPCPCPTP* APT)-3' ; × 1 ;5'-D(APTPAPGPGPAPCPGPCPTP GPAPCPAPCPTPGPGPTPGPCPTPTPGPGPCPAPGP CPT)-3' ; × 1 ATP* ADENOSINE-5'-TRIPHOSPHATE × 2 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions：pH 7.5；12-14% PEG6000, 150-300MM NACL, 10 MM MGCL2, 25 MM HEPES PH 7.5, 100 UM ADP	Resolution 2.27 Å R-free 0.253

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1W7A	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1E3M The crystal structure of E. coli MutS binding to DNA with a G:T mismatch Deposited 2000-06-19	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–800（800 aa） Fragment：RESIDUES 1-800 Chain B 1–800（800 aa） Fragment：RESIDUES 1-800	Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF)	ADP ADENOSINE-5'-DIPHOSPHATE × 1 MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 7；12-14 % PEG 6000, 150-300 MM NACL, 100 MM HEPES PH 7-8, 10 MM MGCL2, 100-150 MICROM ADP	Resolution 2.20 Å R-free 0.266
1NG9 E.coli MutS R697A: an ATPase-asymmetry mutant Deposited 2002-12-17	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–800（800 aa） Fragment：residues 1-800 Chain B 1–800（800 aa） Fragment：residues 1-800	Mutation：R697A Mutation：R697A	MG MAGNESIUM ION × 2 ADP ADENOSINE-5'-DIPHOSPHATE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；297 K；PEG 6000, NaCl, MgCl2, HEPES, ADP, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 297K	Resolution 2.60 Å R-free 0.249
1OH5 THE CRYSTAL STRUCTURE OF E. COLI MUTS BINDING TO DNA WITH A C:A MISMATCH Deposited 2003-05-23	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–800（800 aa） Fragment：RESIDUES 1-800 Chain B 1–800（800 aa） Fragment：RESIDUES 1-800	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 7；12-14 % PEG 6000, 150-300 MM NACL 25 MM HEPES PH 7-8, 10 MM MGCL2, 100-150 MICROM ADP	Resolution 2.90 Å R-free 0.294
1OH6 THE CRYSTAL STRUCTURE OF E. COLI MUTS BINDING TO DNA WITH AN A:A MISMATCH Deposited 2003-05-23	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–800（800 aa） Fragment：RESIDUES 1-800 Chain B 1–800（800 aa） Fragment：RESIDUES 1-800	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 7；12-14 % PEG 6000, 150-300 MM NACL 25 MM HEPES PH 7-8, 10 MM MGCL2, 100-150 MICROM ADP	Resolution 2.40 Å R-free 0.253
1OH7 THE CRYSTAL STRUCTURE OF E. COLI MUTS BINDING TO DNA WITH A G:G MISMATCH Deposited 2003-05-23	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–800（800 aa） Fragment：RESIDUES 1-800 Chain B 1–800（800 aa） Fragment：RESIDUES 1-800	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 7；12-14 % PEG 6000, 150-300 MM NACL 25 MM HEPES PH 7-8, 10 MM MGCL2, 100-150 MICROM ADP	Resolution 2.50 Å R-free 0.276
1OH8 THE CRYSTAL STRUCTURE OF E. COLI MUTS BINDING TO DNA WITH AN UNPAIRED THYMIDINE Deposited 2003-05-23	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–800（800 aa） Fragment：RESIDUES 1-800 Chain B 1–800（800 aa） Fragment：RESIDUES 1-800	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 7；12-14 % PEG 6000, 150-300 MM NACL 25 MM HEPES PH 7-8, 10 MM MGCL2, 100-150 MICROM ADP	Resolution 2.90 Å R-free 0.292
1WB9 Crystal Structure of E. coli DNA Mismatch Repair enzyme MutS, E38T mutant, in complex with a G.T mismatch Deposited 2004-10-31	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–800（800 aa） Fragment：RESIDUES 1-800 Chain B 1–800（800 aa） Fragment：RESIDUES 1-800	Mutation：YES Mutation：YES	ADP ADENOSINE-5'-DIPHOSPHATE × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；25 MM HEPES(7.5), 300 MM NACL, 10 MM MGCL2, 14 % PEG 6000., pH 7.50	Resolution 2.10 Å R-free 0.234
1WBB Crystal structure of E. coli DNA mismatch repair enzyme MutS, E38A mutant, in complex with a G.T mismatch Deposited 2004-10-31	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–800（800 aa） Fragment：RESIDUES 1-800 Chain B 1–800（800 aa） Fragment：RESIDUES 1-800	Mutation：YES Mutation：YES	ADP ADENOSINE-5'-DIPHOSPHATE × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；25 MM HEPES(7.5), 300 MM NACL, 10 MM MGCL2, 14 % PEG 6000., pH 7.50	Resolution 2.50 Å R-free 0.270
1WBD Crystal structure of E. coli DNA mismatch repair enzyme MutS, E38Q mutant, in complex with a G.T mismatch Deposited 2004-10-31	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–800（800 aa） Fragment：RESIDUES 1-800 Chain B 1–800（800 aa） Fragment：RESIDUES 1-800	Mutation：YES Mutation：YES	ADP ADENOSINE-5'-DIPHOSPHATE × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；25 MM HEPES(7.5), 300 MM NACL, 10 MM MGCL2, 14 % PEG 6000., pH 7.50	Resolution 2.40 Å R-free 0.259
2OK2 MutS C-terminal domain fused to Maltose Binding Protein Deposited 2007-01-15	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 820–853（34 aa） Fragment：MBP/MutS C-terminal fusion Chain B 820–853（34 aa） Fragment：MBP/MutS C-terminal fusion	Not recorded	SO4 SULFATE ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.6；298 K；15% PEG 4K, 100 mM sodium citrate, 100 mM lithium acetate, pH 5.6, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 2.00 Å R-free 0.277
2WTU Crystal structure of Escherichia coli MutS in complex with a 16 basepair oligo containing an A.A mismatch. Deposited 2009-09-22	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–800（800 aa） Fragment：RESIDUES 1-800 Chain B 1–800（800 aa） Fragment：RESIDUES 1-800	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 1 CL CHLORIDE ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；18% PEG 3350, 100 MM SODIUM CITRATE, 100 MM BIS TRIS PROPANE PH 7.5, 5 MM MGCL2, 100 MICROM ADP.	Resolution 3.40 Å R-free 0.263
3K0S Crystal structure of E.coli DNA mismatch repair protein MutS, D693N mutant, in complex with GT mismatched DNA Deposited 2009-09-25	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 2–800（799 aa） Fragment：UNP residues 2-800 Chain B 2–800（799 aa） Fragment：UNP residues 2-800	Mutation：D693N Mutation：D693N	ADP ADENOSINE-5'-DIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；293 K；11% PEG 6000, 750mM NaCl, 25mM Hepes, 10mM MgCl2, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 2.20 Å R-free 0.246
3ZLJ CRYSTAL STRUCTURE OF FULL-LENGTH E.COLI DNA MISMATCH REPAIR PROTEIN MUTS D835R MUTANT IN COMPLEX WITH GT MISMATCHED DNA Deposited 2013-02-01	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–800（800 aa） Chain B 1–800（800 aa）	Mutation：YES Mutation：YES	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；293 K；5MM TRIS PH8, 750MM NACL, 12% PEG 6000, 10MM MGCL2, VAPOR DIFFUSION, HANGING DROP, TEMPERATURE 293K, pH 7.5	Resolution 3.10 Å R-free 0.263
3ZLJ CRYSTAL STRUCTURE OF FULL-LENGTH E.COLI DNA MISMATCH REPAIR PROTEIN MUTS D835R MUTANT IN COMPLEX WITH GT MISMATCHED DNA Deposited 2013-02-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 801–853（53 aa） Chain D 801–853（53 aa）	Mutation：YES Mutation：YES	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；293 K；5MM TRIS PH8, 750MM NACL, 12% PEG 6000, 10MM MGCL2, VAPOR DIFFUSION, HANGING DROP, TEMPERATURE 293K, pH 7.5	Resolution 3.10 Å R-free 0.263
5AKB MutS in complex with the N-terminal domain of MutL - crystal form 1 Deposited 2015-03-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain A 1–800（800 aa） Chain B 1–800（800 aa）	Mutation：YES Mutation：YES	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2	X-RAY DIFFRACTION X-ray crystallization conditions 9-12% PEG8000, 100 MM TRIS PH 7.0, 200 MM MGCL2, 80-450 MM SODIUM MALONATE	Resolution 4.71 Å R-free 0.349
5AKB MutS in complex with the N-terminal domain of MutL - crystal form 1 Deposited 2015-03-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain E 1–800（800 aa）	Mutation：YES	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2	X-RAY DIFFRACTION X-ray crystallization conditions 9-12% PEG8000, 100 MM TRIS PH 7.0, 200 MM MGCL2, 80-450 MM SODIUM MALONATE	Resolution 4.71 Å R-free 0.349
5AKC MutS in complex with the N-terminal domain of MutL - crystal form 2 Deposited 2015-03-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain A 1–800（800 aa） Chain B 1–800（800 aa）	Mutation：YES Mutation：YES	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2	X-RAY DIFFRACTION X-ray crystallization conditions 9-12% PEG8000, 100 MM TRIS PH 7.0, 200 MM MGCL2, 80-450 MM SODIUM MALONATE	Resolution 6.60 Å R-free 0.291
5AKC MutS in complex with the N-terminal domain of MutL - crystal form 2 Deposited 2015-03-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain E 1–800（800 aa） Chain F 1–800（800 aa）	Mutation：YES Mutation：YES	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2	X-RAY DIFFRACTION X-ray crystallization conditions 9-12% PEG8000, 100 MM TRIS PH 7.0, 200 MM MGCL2, 80-450 MM SODIUM MALONATE	Resolution 6.60 Å R-free 0.291
5AKC MutS in complex with the N-terminal domain of MutL - crystal form 2 Deposited 2015-03-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain I 1–800（800 aa） Chain J 1–800（800 aa）	Mutation：YES Mutation：YES	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2	X-RAY DIFFRACTION X-ray crystallization conditions 9-12% PEG8000, 100 MM TRIS PH 7.0, 200 MM MGCL2, 80-450 MM SODIUM MALONATE	Resolution 6.60 Å R-free 0.291
5AKD MutS in complex with the N-terminal domain of MutL - crystal form 3 Deposited 2015-03-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain A 1–800（800 aa） Chain B 1–800（800 aa）	Mutation：YES Mutation：YES	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2	X-RAY DIFFRACTION X-ray crystallization conditions 9-12% PEG8000, 100 MM TRIS PH 7.0, 200 MM MGCL2, 80-450 MM SODIUM MALONATE	Resolution 7.60 Å R-free 0.306
5AKD MutS in complex with the N-terminal domain of MutL - crystal form 3 Deposited 2015-03-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain E 1–800（800 aa） Chain F 1–800（800 aa）	Mutation：YES Mutation：YES	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2	X-RAY DIFFRACTION X-ray crystallization conditions 9-12% PEG8000, 100 MM TRIS PH 7.0, 200 MM MGCL2, 80-450 MM SODIUM MALONATE	Resolution 7.60 Å R-free 0.306
5AKD MutS in complex with the N-terminal domain of MutL - crystal form 3 Deposited 2015-03-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain I 1–800（800 aa） Chain J 1–800（800 aa）	Mutation：YES Mutation：YES	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2	X-RAY DIFFRACTION X-ray crystallization conditions 9-12% PEG8000, 100 MM TRIS PH 7.0, 200 MM MGCL2, 80-450 MM SODIUM MALONATE	Resolution 7.60 Å R-free 0.306
6I5F Crystal structure of DNA-free E.coli MutS P839E dimer mutant Deposited 2018-11-13	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–853（853 aa） Chain B 1–853（853 aa）	Not recorded	GOL GLYCEROL × 13 SO4 SULFATE ION × 9 ADP ADENOSINE-5'-DIPHOSPHATE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7；297 K；0.1 M Hepes 7.0 7 % Dioxone 1.4 M Ammonium Sulfate	Resolution 2.60 Å R-free 0.257
7AI6 MutS in mismatch bound state Deposited 2020-09-26	Different construct Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–853（853 aa） Chain B 1–853（853 aa）	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE；blot for 3 seconds before plunging	Resolution 6.90 Å
7AI7 MutS in Intermediate state Deposited 2020-09-26	Different construct Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–853（853 aa） Chain B 1–853（853 aa）	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE；blot for 3 seconds before plunging	Resolution 3.90 Å
7AIB MutS-MutL in clamp state Deposited 2020-09-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric	Chain A 1–853（853 aa） Chain B 1–853（853 aa）	Mutation：D825R,C93A,C235S,C239A,C297S,C569S,C711V,D246C Mutation：D825R,C93A,C235S,C239A,C297S,C569S,C711V,D246C	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE；blot for 3 seconds before plunging	Resolution 4.70 Å
7AIC MutS-MutL in clamp state (kinked clamp domain) Deposited 2020-09-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric	Chain A 1–853（853 aa） Chain B 1–853（853 aa）	Mutation：D825R, C93A, C235S, C239A, C297S, C569S, C711V, D246C Mutation：D825R, C93A, C235S, C239A, C297S, C569S, C711V, D246C	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE；blot for 3 seconds before plunging	Resolution 5.00 Å
7OTO The structure of MutS bound to two molecules of AMPPNP Deposited 2021-06-10	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–800（800 aa） Chain B 1–800（800 aa）	Not recorded	MG MAGNESIUM ION × 2 ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 8.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.40 Å
7OU0 The structure of MutS bound to two molecules of ADP-Vanadate Deposited 2021-06-10	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–799（799 aa） Chain B 1–799（799 aa）	Mutation：R840E Mutation：R840E	MG MAGNESIUM ION × 2 ADP ADENOSINE-5'-DIPHOSPHATE × 2 VO4 VANADATE ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 8.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.80 Å
7OU4 The structure of MutS bound to one molecule of ATP and one molecule of ADP Deposited 2021-06-11	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–800（800 aa） Chain B 1–800（800 aa）	Not recorded	MG MAGNESIUM ION × 2 ATP ADENOSINE-5'-TRIPHOSPHATE × 1 ADP ADENOSINE-5'-DIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 8.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å

24 other PDB entries and 30 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	MUTS_ECOLI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–800； UniProt 1–800 Author chain B； PDBConstruct 1–800； UniProt 1–800

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1w7a
Deposition date deposition_date	2004-08-31
Structure title title	ATP bound MutS
Keywords keywords	DNA BINDING, ABC ATPASE, ALTERNATING ATPASE, ASYMMETRY, ATP-BINDING, DNA REPAIR, DNA-BINDING; DNA BINDING
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	40.93 Å
Radius of gyration Rg (electron density) rg_electron	40.32 Å
Forward intensity I(0) i0	568878000.00
Molecular weight molecular_weight	185970.0 kDa
Excluded volume excluded_volume	229120 Å³
Envelope volume envelope_volume	323510 Å³
Hydration-shell volume shell_volume	65232 Å³
Envelope diameter envelope_diameter	131.8 Å
Shell Rg shell_rg	47.89 Å
Envelope Rg envelope_rg	39.06 Å
Shape Rg shape_rg	40.33 Å
Total Rg total_rg	40.68 Å
Total atoms total_atoms	13019
Residues n_residues	1588
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	130.1 Å
Rg (real space) rg_real	40.78 Å
Rg uncertainty (real space) rg_real_error	0.96 Å
I(0) (real space) i0_real	5.6890e+08
I(0) uncertainty (real space) i0_real_error	9.6630e+06
Rg (reciprocal space) rg_reciprocal	40.93 Å
I(0) (reciprocal space) i0_reciprocal	569000000.0000
Solution quality estimate total_estimate	0.9000
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	53.4 Å
Skewness Skewness skewness	0.137
Kurtosis Kurtosis kurtosis	-0.546
Angular range angular_range	— – 0.1950 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	51570000.0000
Real-space data points n_real_points	40
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.935; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.999; Smooth: 0.893

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	DNA MISMATCH REPAIR PROTEIN MUTS
Molecular weight formula_weight	89604.4 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	13285

MSAIENFDAHTPMMQQYLRLKAQHPEILLFYRMGDFYELFYDDAKRASQLLDISLTKRGASAGEPIPMAGIPYHAVENYLAKLVNQGESVAICEQIGDPATSKGPVERKVVRIVTPGTISDEALLQERQDNLLAAIWQDSKGFGYATLDISSGRFRLSEPADRETMAAELQRTNPAELLYAEDFAEMSLIEGRRGLRRRPLWEFEIDTARQQLNLQFGTRDLVGFGVENAPRGLCAAGCLLQYAKDTQRTTLPHIRSITMEREQDSIIMDAATRRNLEITQNLAGGAENTLASVLDCTVTPMGSRMLKRWLHMPVRDTRVLLERQQTIGALQDFTAGLQPVLRQVGDLERILARLALRTARPRDLARMRHAFQQLPELRAQLETVDSAPVQALREKMGEFAELRDLLERAIIDTPPVLVRDGGVIASGYNEELDEWRALADGATDYLERLEVRERERTGLDTLKVGFNAVHGYYIQISRGQSHLAPINYMRRQTLKNAERYIIPELKEYEDKVLTSKGKALALEKQLYEELFDLLLPHLEALQQSASALAELDVLVNLAERAYTLNYTCPTFIDKPGIRITEGRHPVVEQVLNEPFIANPLNLSPQRRMLIITGPNMGGKSTYMRQTALIALMAYIGSYVPAQKVEIGPIDRIFTRVGAADDLASGRSTFMVEMTETANILHNATEYSLVLMDEIGRGTSTYDGLSLAWACAENLANKIKALTLFATHYFELTQLPEKMEGVANVHLDALEHGDTIAFMHSVQDGAASKSYGLAVAALAGVPKEVIKRARQKLRELESIS

来源 Source

来源生物 organism	ESCHERICHIA COLI
NCBI Class编号 ncbi_taxonomy_id	562
宿主生物 host_organism	ESCHERICHIA COLI

Entity 2 Entity 2 polymer

Description description	;5'-D(APGPCPTPGPCPCPAPGPGP CPAPCPCPAPGPTPGPTPCPAPGPCPGPTPCPCPTP* AP*T)-3' ;
Molecular weight formula_weight	9184.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

AGCTGCCAGGCACCAGTGTCAGCGTCCTAT

Entity 3 Entity 3 polymer

Description description	;5'-D(APTPAPGPGPAPCPGPCPTP GPAPCPAPCPTPGPGPTPGPCPTPTPGPGPCPAPGP* CP*T)-3' ;
Molecular weight formula_weight	9280.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F

ATAGGACGCTGACACTGGTGCTTGGCAGCT

Entity 4 Entity 4 non-polymer

Description description	ADENOSINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	507.2 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	266

▼

7. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (8 domains)

Domain ID domain_id	d1w7aa1
Class class	a — All alpha proteins
Fold Fold fold	a.113 — DNA repair protein MutS, domain III
Superfamily Superfamily superfamily	a.113.1 — DNA repair protein MutS, domain III
Family Family family	a.113.1.1 — DNA repair protein MutS, domain III

Domain ID domain_id	d1w7aa2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.12 — ABC transporter ATPase domain-like

Domain ID domain_id	d1w7aa3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.55 — Ribonuclease H-like motif
Superfamily Superfamily superfamily	c.55.6 — DNA repair protein MutS, domain II
Family Family family	c.55.6.1 — DNA repair protein MutS, domain II

Domain ID domain_id	d1w7aa4
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.75 — MutS N-terminal domain-like
Superfamily Superfamily superfamily	d.75.2 — DNA repair protein MutS, domain I
Family Family family	d.75.2.1 — DNA repair protein MutS, domain I

Domain ID domain_id	d1w7ab1
Class class	a — All alpha proteins
Fold Fold fold	a.113 — DNA repair protein MutS, domain III
Superfamily Superfamily superfamily	a.113.1 — DNA repair protein MutS, domain III
Family Family family	a.113.1.1 — DNA repair protein MutS, domain III

Domain ID domain_id	d1w7ab2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.12 — ABC transporter ATPase domain-like

Domain ID domain_id	d1w7ab3
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.55 — Ribonuclease H-like motif
Superfamily Superfamily superfamily	c.55.6 — DNA repair protein MutS, domain II
Family Family family	c.55.6.1 — DNA repair protein MutS, domain II

Domain ID domain_id	d1w7ab4
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.75 — MutS N-terminal domain-like
Superfamily Superfamily superfamily	d.75.2 — DNA repair protein MutS, domain I
Family Family family	d.75.2.1 — DNA repair protein MutS, domain I

CATH v4.4 (10 domains)

Domain ID domain_id	1w7aA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	1170 — MutS, DNA mismatch repair protein, domain I
Homologous superfamily homologous superfamily	10 — DNA repair protein MutS, domain I

Domain ID domain_id	1w7aA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	110 — MutS, connector domain

Domain ID domain_id	1w7aA03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1420 — MutS, DNA mismatch repair protein; Chain A, domain 3
Homologous superfamily homologous superfamily	10 —

Domain ID domain_id	1w7aA04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1420 — MutS, DNA mismatch repair protein; Chain A, domain 3
Homologous superfamily homologous superfamily	10 —

Domain ID domain_id	1w7aA05
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	1w7aB01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	1170 — MutS, DNA mismatch repair protein, domain I
Homologous superfamily homologous superfamily	10 — DNA repair protein MutS, domain I

Domain ID domain_id	1w7aB02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	110 — MutS, connector domain

Domain ID domain_id	1w7aB03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1420 — MutS, DNA mismatch repair protein; Chain A, domain 3
Homologous superfamily homologous superfamily	10 —

Domain ID domain_id	1w7aB04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1420 — MutS, DNA mismatch repair protein; Chain A, domain 3
Homologous superfamily homologous superfamily	10 —

Domain ID domain_id	1w7aB05
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

▶

8. Citations (1)

▶

Unit-cell length a length_a	90.636 Å
Unit-cell length b length_b	93.040 Å
Unit-cell length c length_c	262.592 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	2.270 Å
Low-resolution limit resolution_low	20.000 Å
R factor r_factor	0.2170
R_work r_work	0.2160
R_free r_free	0.2530

fit	/app/data/saxs_computation/w7/1w7a/1w7a.fit
pddf	/app/data/pr_computation/w7/1w7a/1w7a.pr.out
profile	/app/data/saxs_computation/w7/1w7a/1w7a.dat

ATP bound MutS

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA MISMATCH REPAIR PROTEIN MUTS

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

7. Fold Classification (SCOP + CATH) 18 domains

SCOP 2.08 (8 domains)

CATH v4.4 (10 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)