SAXSdb — 7aib

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA mismatch repair protein MutS

Escherichia coli (strain K12)

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	DNA mismatch repair protein MutL × 1 （P23367） DNA (30-MER) × 1 DNA (30-MER) × 1 PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MUTS_ECOLI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–853； UniProt 1–853 Author chain B； PDBConstruct 1–853； UniProt 1–853

DNA mismatch repair protein MutL

Escherichia coli (strain K12)

UniProt P23367

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	DNA mismatch repair protein MutS × 2 （P23909） DNA (30-MER) × 1 DNA (30-MER) × 1 PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MUTL_ECOLI
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain C； PDBConstruct 21–351； UniProt 1–331

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	7aib
Deposition date deposition_date	2020-09-26
Structure title title	MutS-MutL in clamp state
Keywords keywords	DNA Mismatch Repair MutS, DNA BINDING PROTEIN; DNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

7aib__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

7aib__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

7aib__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	40.27 Å
Rg (electron density)	40.01 Å
Total Rg	40.26 Å
Atom count	13839
Residues	1651
Excluded volume	241890 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`7aib__assembly_1__model_1`	pentameric （5）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	DNA mismatch repair protein MutS
Molecular weight formula_weight	95269.6 kDa
Mutation mutation	D825R,C93A,C235S,C239A,C297S,C569S,C711V,D246C
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	13839

MSAIENFDAHTPMMQQYLRLKAQHPEILLFYRMGDFYELFYDDAKRASQLLDISLTKRGASAGEPIPMAGIPYHAVENYLAKLVNQGESVAIAEQIGDPATSKGPVERKVVRIVTPGTISDEALLQERQDNLLAAIWQDSKGFGYATLDISSGRFRLSEPADRETMAAELQRTNPAELLYAEDFAEMSLIEGRRGLRRRPLWEFEIDTARQQLNLQFGTRDLVGFGVENAPRGLSAAGALLQYAKCTQRTTLPHIRSITMEREQDSIIMDAATRRNLEITQNLAGGAENTLASVLDSTVTPMGSRMLKRWLHMPVRDTRVLLERQQTIGALQDFTAGLQPVLRQVGDLERILARLALRTARPRDLARMRHAFQQLPELRAQLETVDSAPVQALREKMGEFAELRDLLERAIIDTPPVLVRDGGVIASGYNEELDEWRALADGATDYLERLEVRERERTGLDTLKVGFNAVHGYYIQISRGQSHLAPINYMRRQTLKNAERYIIPELKEYEDKVLTSKGKALALEKQLYEELFDLLLPHLEALQQSASALAELDVLVNLAERAYTLNYTSPTFIDKPGIRITEGRHPVVEQVLNEPFIANPLNLSPQRRMLIITGPNMGGKSTYMRQTALIALMAYIGSYVPAQKVEIGPIDRIFTRVGAADDLASGRSTFMVEMTETANILHNATEYSLVLMDEIGRGTSTYDGLSLAWAVAENLANKIKALTLFATHYFELTQLPEKMEGVANVHLDALEHGDTIAFMHSVQDGAASKSYGLAVAALAGVPKEVIKRARQKLRELESISPNAAATQVDGTQMSLLSVPEETSPAVEALENLDPRSLTPRQALEWIYRLKSLV

Source Source

Source organism organism	Escherichia coli (strain K12)
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	DNA mismatch repair protein MutL
Molecular weight formula_weight	39248.5 kDa
Mutation mutation	N131C,C61S,C216L,C256F,C276Y
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C

MGSSHHHHHHSSGLVPRGSHMPIQVLPPQLANQIAAGEVVERPASVVKELVENSLDAGATRIDIDIERGGAKLIRIRDNGSGIKKDELALALARHATSKIASLDDLEAIISLGFRGEALASISSVSRLTLTSRTAEQQEAWQAYAEGRDMCVTVKPAAHPVGTTLEVLDLFYNTPARRKFLRTEKTEFNHIDEIIRRIALARFDVTINLSHNGKIVRQYRAVPEGGQKERRLGAILGTAFLEQALAIEWQHGDLTLRGWVADPNHTTPALAEIQYFYVNGRMMRDRLINHAIRQAYEDKLGADQQPAFVLYLEIDPHQVDVNVHPAKHEVRFHQSRLVHDFIYQGVLSVLQ

Source Source

Source organism organism	Escherichia coli (strain K12)
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	DNA (30-MER)
Molecular weight formula_weight	9304.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

ATGCCTATAGGGCGAATTGGGTACCGCTGA

Entity 4 Entity 4 polymer

Description description	DNA (30-MER)
Molecular weight formula_weight	9143.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

TCAGCGGTACCCAATTCGCCCTATAGGCAT

Entity 5 Entity 5 non-polymer

Description description	PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER
Molecular weight formula_weight	506.2 kDa
Source method src_method	syn
Copy count entity_count	2

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	4.70 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	34922

MutS-MutL in clamp state

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA mismatch repair protein MutS

State in the Current Structure

Other States of the Same Protein in the Database

DNA mismatch repair protein MutL

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7aib__assembly_1__model_1

7aib__assembly_1__model_1 | I(q)

7aib__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

7. Citations (1)

MutS-MutL in clamp state

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA mismatch repair protein MutS

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA mismatch repair protein MutL

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7aib__assembly_1__model_1

7aib__assembly_1__model_1 | I(q)

7aib__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

7. Citations (1)