SAXSdb — 2a0i

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

TraI protein

Escherichia coli

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Monomer	Protein 1 DNA 1	F plasmid single-stranded oriT DNA × 1 MAGNESIUM ION × 1 IMIDAZOLE × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	TRAI1_ECOLI
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–330； UniProt 1–330

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2a0i
Deposition date deposition_date	2005-06-16
Structure title title	F Factor TraI Relaxase Domain bound to F oriT Single-stranded DNA
Keywords keywords	single-stranded DNA, protein-DNA complex, 5-strand antiparallel beta sheet, hydrolase-DNA COMPLEX; hydrolase/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

2a0i__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

2a0i__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

2a0i__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	20.78 Å
Rg (electron density)	20.02 Å
Total Rg	20.83 Å
Atom count	2457
Residues	303
Excluded volume	42433 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`2a0i__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	F plasmid single-stranded oriT DNA
Molecular weight formula_weight	6932.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B
Atom count atom_count	2524

TGGGGTGTGGTGCTTTTGGTGG

Entity 2 Entity 2 polymer

Description description	TraI protein
Molecular weight formula_weight	36326.5 kDa
EC 编号 ec_number	3.6.1.-
Mutation mutation	Y16F
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MMSIAQVRSAGSAGNFYTDKDNYYVLGSMGERWAGRGAEQLGLQGSVDKDVFTRLLEGRLPDGADLSRMQDGSNRHRPGYDLTFSAPKSVSMMAMLGGDKRLIDAHNQAVDFAVRQVEALASTRVMTDGQSETVLTGNLVMALFNHDTSRDQEPQLHTHAVVANVTQHNGEWKTLSSDKVGKTGFIENVYANQIAFGRLYREKLKEQVEALGYETEVVGKHGMWEMPGVPVEAFSGRSQTIREAVGEDASLKSRDVAALDTRKSKQHVDPEIKMAEWMQTLKETGFDIRAYRDAADQRADLRTLTPGPASQDGPDVQQAVTQAIAGLSER

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 3 Entity 3 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 4 Entity 4 non-polymer

Description description	IMIDAZOLE
Molecular weight formula_weight	69.1 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	67

▶

Unit-cell length a length_a	77.515 Å
Unit-cell length b length_b	77.515 Å
Unit-cell length c length_c	114.369 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	6

Space group space_group	P 62
Space-group number int_tables_number	171
Crystal system crystal_system	—

Resolution resolution	2.720 Å
Low-resolution limit resolution_low	14.870 Å
R factor r_factor	0.2210
R_work r_work	0.2150
R_free r_free	0.2720

F Factor TraI Relaxase Domain bound to F oriT Single-stranded DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

TraI protein

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2a0i__assembly_1__model_1

2a0i__assembly_1__model_1 | I(q)

2a0i__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

7. Citations (2)

F Factor TraI Relaxase Domain bound to F oriT Single-stranded DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

TraI protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2a0i__assembly_1__model_1

2a0i__assembly_1__model_1 | I(q)

2a0i__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

7. Citations (2)