SAXSdb — 2azx

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tryptophanyl-tRNA synthetase

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Homooligomer	Protein 2 RNA 2	72-MER × 2 SULFATE ION × 8 TRYPTOPHAN × 4 water × 4	Consistent with all polymers
2	Protein–RNA	Homooligomer	Protein 2 RNA 2	72-MER × 2 SULFATE ION × 12 TRYPTOPHAN × 2 MAGNESIUM ION × 2 GLYCEROL × 4 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYW_HUMAN
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–471； UniProt 1–471 Author chain B； PDBConstruct 1–471； UniProt 1–471

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2azx
Deposition date deposition_date	2005-09-12
Structure title title	Charged and uncharged tRNAs adopt distinct conformations when complexed with human tryptophanyl-tRNA synthetase
Keywords keywords	two synthetase-tRNA complex with distinct conformations, association complex and dissociation complex, Ligase-RNA COMPLEX; Ligase/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

2azx__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

2azx__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

2azx__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	37.54 Å
Rg (electron density)	36.16 Å
Total Rg	36.61 Å
Atom count	9410
Residues	898
Excluded volume	156360 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`2azx__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`2azx__assembly_2__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	72-MER
Molecular weight formula_weight	24180.4 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C,D
Atom count atom_count	9445

GACCUCGUGGCGCAAUGGUAGCGCGUCUGACUCCAGAUCAGAAGGUUGCGUGUUCGAAUCACGUCGGGGUCACCA

Entity 2 Entity 2 polymer

Description description	Tryptophanyl-tRNA synthetase
Molecular weight formula_weight	54591.6 kDa
EC 编号 ec_number	6.1.1.2
Mutation mutation	S213G, Y214D
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

MPNSEPASLLELFNSIATQGELVRSLKAGNASKDEIDSAVKMLVSLKMSYKAAAGEDYKADCPPGNPAPTSNHGPDATEAEEDFVDPWTVQTSSAKGIDYDKLIVRFGSSKIDKELINRIERATGQRPHHFLRRGIFFSHRDMNQVLDAYENKKPFYLYTGRGPSSEAMHVGHLIPFIFTKWLQDVFNVPLVIQMTDDEKYLWKDLTLDQAYGDAVENAKDIIACGFDINKTFIFSDLDYMGMSSGFYKNVVKIQKHVTFNQVKGIFGFTDSDCIGKISFPAIQAAPSFSNSFPQIFRDRTDIQCLIPCAIDQDPYFRMTRDVAPRIGYPKPALLHSTFFPALQGAQTKMSASDPNSSIFLTDTAKQIKTKVNKHAFSGGRDTIEEHRQFGGNCDVDVSFMYLTFFLEDDDKLEQIRKDYTSGAMLTGELKKALIEVLQPLIAEHQARRKEVTDEIVKEFMTPRKLSFDFQHHHHHH

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 3 Entity 3 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	10

Entity 4 Entity 4 non-polymer

Description description	TRYPTOPHAN
Molecular weight formula_weight	204.2 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 5 Entity 5 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 non-polymer

Description description	GLYCEROL
Molecular weight formula_weight	92.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 7 Entity 7 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	22

▼

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (2 domains)

Domain ID domain_id	d2azxa1
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.26 — Adenine nucleotide alpha hydrolase-like
Superfamily Superfamily superfamily	c.26.1 — Nucleotidylyl transferase
Family Family family	c.26.1.1 — Class I aminoacyl-tRNA synthetases (RS), catalytic domain

Domain ID domain_id	d2azxb1
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.26 — Adenine nucleotide alpha hydrolase-like
Superfamily Superfamily superfamily	c.26.1 — Nucleotidylyl transferase
Family Family family	c.26.1.1 — Class I aminoacyl-tRNA synthetases (RS), catalytic domain

CATH v4.4 (4 domains)

Domain ID domain_id	2azxA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	2azxA02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	240 — Tyrosyl-Transfer RNA Synthetase
Homologous superfamily homologous superfamily	10 — Tyrosyl-Transfer RNA Synthetase

Domain ID domain_id	2azxB01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	2azxB02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	240 — Tyrosyl-Transfer RNA Synthetase
Homologous superfamily homologous superfamily	10 — Tyrosyl-Transfer RNA Synthetase

▶

Unit-cell length a length_a	114.058 Å
Unit-cell length b length_b	132.621 Å
Unit-cell length c length_c	246.633 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	I 21 21 21
Space-group number int_tables_number	24
Crystal system crystal_system	—

Resolution resolution	2.800 Å
Low-resolution limit resolution_low	50.000 Å
R factor r_factor	0.2110
R_work r_work	0.2050
R_free r_free	0.2520

Charged and uncharged tRNAs adopt distinct conformations when complexed with human tryptophanyl-tRNA synthetase

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tryptophanyl-tRNA synthetase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2azx__assembly_1__model_1

2azx__assembly_1__model_1 | I(q)

2azx__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 water

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (2 domains)

CATH v4.4 (4 domains)

7. Citations (1)

Charged and uncharged tRNAs adopt distinct conformations when complexed with human tryptophanyl-tRNA synthetase

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tryptophanyl-tRNA synthetase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2azx__assembly_1__model_1

2azx__assembly_1__model_1 | I(q)

2azx__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 water

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (2 domains)

CATH v4.4 (4 domains)

7. Citations (1)