2d6f

Crystal structure of Glu-tRNA(Gln) amidotransferase in the complex with tRNA(Gln)

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Glutamyl-tRNA(Gln) amidotransferase subunit D

Methanothermobacter thermautotrophicus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 4 RNA 2	tRNA × 2 Glutamyl-tRNA(Gln) amidotransferase subunit E × 2 （O26803） ZINC ION × 2 water × 6	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	GATD_METTH
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–435； UniProt 1–435 Author chain B； PDBConstruct 1–435； UniProt 1–435

Glutamyl-tRNA(Gln) amidotransferase subunit E

Methanothermobacter thermautotrophicus

UniProt O26803

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 4 RNA 2	tRNA × 2 Glutamyl-tRNA(Gln) amidotransferase subunit D × 2 （O26802） ZINC ION × 2 water × 6	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	GATE_METTH
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain C； PDBConstruct 1–619； UniProt 1–619 Author chain D； PDBConstruct 1–619； UniProt 1–619

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2d6f
Deposition date deposition_date	2005-11-13
Structure title title	Crystal structure of Glu-tRNA(Gln) amidotransferase in the complex with tRNA(Gln)
Keywords keywords	ligase, RNA, ligase-RNA COMPLEX; ligase/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

2d6f__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

2d6f__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

2d6f__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	53.14 Å
Rg (electron density)	50.57 Å
Total Rg	51.03 Å
Atom count	17636
Residues	2001
Excluded volume	301000 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`2d6f__assembly_1__model_1`	hexameric （6）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	tRNA
Molecular weight formula_weight	23835.1 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	E,F
Atom count atom_count	17816

AGUCCCGUGGGGUAGUGGUAAUCCUGCUGGGCUUUGGACCCGGCGACAGCGGUUCGACUCCGCUCGGGACUACC

Entity 2 Entity 2 polymer

Description description	Glutamyl-tRNA(Gln) amidotransferase subunit D
Molecular weight formula_weight	48053.4 kDa
EC 编号 ec_number	6.3.5.-
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

MSYQGRARKFLESASIDVGDMVLVEKPDVTYEGMVLDRADDADDRHIVLKLENGYNIGVEISDARIELLEKGSEPRIELPPVEAAEDPELPDVSIISTGGTVASIIDYRTGAVHPAFTADDLLRANPELLDIANIRGRAVFNILSENMKPEYWVETARAVYGEIKDGADGVVVAHGTDTMHYTSAALSFMLRTPVPVVFTGAQRSSDRPSSDASLNIQCSVRAATSEIAEVTVCMHATMDDLSCHLHRGVKVRKMHTSRRDTFRSMNALPLAEVTPDGIKILEENYRKRGSDELELSDRVEERVAFIKSYPGISPDIIKWHLDEGYRGIVIEGTGLGHCPDTLIPVIGEAHDMGVPVAMTSQCLNGRVNMNVYSTGRRLLQAGVIPCDDMLPEVAYVKMCWVLGQTDDPEMAREMMRENIAGEINERTSIAYFRG

Source Source

Source organism organism	Methanothermobacter thermautotrophicus
NCBI taxonomy ID ncbi_taxonomy_id	145262
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	Glutamyl-tRNA(Gln) amidotransferase subunit E
Molecular weight formula_weight	69626.2 kDa
EC 编号 ec_number	6.3.5.-
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C,D

MDWEKVGLKMGLEIHQQLDTESKLFCPCRTELTDSEPDHDIVRNLRPTQSELGKFDRAAFEEAMRKLHFHYENYHEETCLVEADEEPPHPLNPEALEIAVTIALLLNMRVVDEFHTMRKQVIDGSNTGGFQRTGLVATDGHLETPQGTVKIENLCLEEDAARRIRETGDGVVFRLDRLGIPLVEITTDPSMSDPQQLREVAYQIGQILRSTRVKRGLGTIRQDLNISIRDGARVEVKGVQDLDLIPEIVEREVKRQLSLVEIRDTLQERGAVVEDKIFDVSEVFADTESRIISSAESVLAVKLRGFDGLIGVEIQPGRRLGTEMADYAKKRGVSGIFHTDELPAYGITEEEVRGLRDAVGASQGDAVVMVAHERVTAENALREVIRRAEMAIQGVPEETRKALPDGNTQYLRPLPTSSRMYLETDIPLFRIEDDLLEGIRRNLPELPSEKKERIMRDYGLSEDLASQLVKRNLVDEFEALTEFRVDTTVIASLLAYTLRELRREGHDVDGLGLDELRDAIKLLEVGKISKDALRDIVACMADEGLAAEDAARKLNLLLLAEDEIESIIQEIVEGNLDMISERGMGAMGPLMGQAMGRLRGRADGKVVNRILREKIQERL

Source Source

Source organism organism	Methanothermobacter thermautotrophicus
NCBI taxonomy ID ncbi_taxonomy_id	145262
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	180

▼

6. Fold Classification (SCOP + CATH) 19 domains

SCOP 2.08 (10 domains)

Domain ID domain_id	d2d6fa1
Class class	b — All beta proteins
Fold Fold fold	b.38 — Sm-like fold
Superfamily Superfamily superfamily	b.38.3 — GatD N-terminal domain-like
Family Family family	b.38.3.1 — GatD N-terminal domain-like

Domain ID domain_id	d2d6fa2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.88 — Glutaminase/Asparaginase
Superfamily Superfamily superfamily	c.88.1 — Glutaminase/Asparaginase
Family Family family	c.88.1.1 — Glutaminase/Asparaginase

Domain ID domain_id	d2d6fb1
Class class	b — All beta proteins
Fold Fold fold	b.38 — Sm-like fold
Superfamily Superfamily superfamily	b.38.3 — GatD N-terminal domain-like
Family Family family	b.38.3.0 — automated matches

Domain ID domain_id	d2d6fb2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.88 — Glutaminase/Asparaginase
Superfamily Superfamily superfamily	c.88.1 — Glutaminase/Asparaginase
Family Family family	c.88.1.1 — Glutaminase/Asparaginase

Domain ID domain_id	d2d6fc1
Class class	a — All alpha proteins
Fold Fold fold	a.182 — GatB/YqeY motif
Superfamily Superfamily superfamily	a.182.1 — GatB/YqeY motif
Family Family family	a.182.1.2 — GatB/GatE C-terminal domain-like

Domain ID domain_id	d2d6fc2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.74 — DCoH-like
Superfamily Superfamily superfamily	d.74.4 — GAD domain-like
Family Family family	d.74.4.1 — GAD domain

Domain ID domain_id	d2d6fc3
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.128 — Glutamine synthetase/guanido kinase
Superfamily Superfamily superfamily	d.128.1 — Glutamine synthetase/guanido kinase
Family Family family	d.128.1.5 — GatB/GatE catalytic domain-like

Domain ID domain_id	d2d6fd1
Class class	a — All alpha proteins
Fold Fold fold	a.182 — GatB/YqeY motif
Superfamily Superfamily superfamily	a.182.1 — GatB/YqeY motif
Family Family family	a.182.1.2 — GatB/GatE C-terminal domain-like

Domain ID domain_id	d2d6fd2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.74 — DCoH-like
Superfamily Superfamily superfamily	d.74.4 — GAD domain-like
Family Family family	d.74.4.1 — GAD domain

Domain ID domain_id	d2d6fd3
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.128 — Glutamine synthetase/guanido kinase
Superfamily Superfamily superfamily	d.128.1 — Glutamine synthetase/guanido kinase
Family Family family	d.128.1.5 — GatB/GatE catalytic domain-like

CATH v4.4 (9 domains)

Domain ID domain_id	2d6fA01
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	520 —

Domain ID domain_id	2d6fA02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	1170 — L-asparaginase, N-terminal domain

Domain ID domain_id	2d6fA03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	2d6fB01
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	520 —

Domain ID domain_id	2d6fB02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	1170 — L-asparaginase, N-terminal domain

Domain ID domain_id	2d6fB03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	40 —

Domain ID domain_id	2d6fC02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	1360 — Gyrase A; domain 2
Homologous superfamily homologous superfamily	30 — GAD-like domain

Domain ID domain_id	2d6fC03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	380 — GatB domain, N-terminal subdomain

Domain ID domain_id	2d6fD02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	1360 — Gyrase A; domain 2
Homologous superfamily homologous superfamily	30 — GAD-like domain

▶

Unit-cell length a length_a	118.812 Å
Unit-cell length b length_b	140.706 Å
Unit-cell length c length_c	186.044 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	3.150 Å
Low-resolution limit resolution_low	46.520 Å
R factor r_factor	0.2300
R_work r_work	0.2300
R_free r_free	0.2920

Crystal structure of Glu-tRNA(Gln) amidotransferase in the complex with tRNA(Gln)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Glutamyl-tRNA(Gln) amidotransferase subunit D

State in the Current Structure

Other States of the Same Protein in the Database

Glutamyl-tRNA(Gln) amidotransferase subunit E

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2d6f__assembly_1__model_1

2d6f__assembly_1__model_1 | I(q)

2d6f__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 19 domains

SCOP 2.08 (10 domains)

CATH v4.4 (9 domains)

7. Citations (1)

Crystal structure of Glu-tRNA(Gln) amidotransferase in the complex with tRNA(Gln)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Glutamyl-tRNA(Gln) amidotransferase subunit D

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Glutamyl-tRNA(Gln) amidotransferase subunit E

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2d6f__assembly_1__model_1

2d6f__assembly_1__model_1 | I(q)

2d6f__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 19 domains

SCOP 2.08 (10 domains)

CATH v4.4 (9 domains)

7. Citations (1)