SAXSdb — 2f03

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Type II restriction enzyme SfiI

OrganismNot specified

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 4 DNA 8	;DNA (5'-D(APTPGTPGPGPCPCPAPAPCPAPAPGPGPCPCPTPAPTPT)-3') ; × 4 ;DNA (5'-D(APAPTPAPGPGPCPCPTPTPGPTPTPGPGPCPCPAPCPAPT)-3') ; × 4 CALCIUM ION × 4 water × 10	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	T2S1_STRFI
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–269； UniProt 1–269 Author chain C； PDBConstruct 1–269； UniProt 1–269

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2f03
Deposition date deposition_date	2005-11-11
Structure title title	Crystal structure of tetrameric restriction endonuclease SfiI in complex with cognate DNA (partial bound form)
Keywords keywords	Type IIF restriction endonuclease, protein-DNA complex, deoxyribonuclease, Hydrolase-DNA COMPLEX; Hydrolase/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

2f03__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

2f03__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

2f03__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	33.82 Å
Rg (electron density)	31.93 Å
Total Rg	32.66 Å
Atom count	9602
Residues	1110
Excluded volume	167010 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`2f03__assembly_1__model_1`	dodecameric （12）	Success	4.1.3-1-20251215 (887e7ef)	View Download
1	2	`2f03__assembly_1__model_2`	dodecameric （12）	Excluded	—	—
	Exclusion reason： The official assembly declares water, but that component is absent from the generated coordinate model, leaving the structure composition incomplete.

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	;DNA (5'-D(APTPGTPGPGPCPCPAPAPCPAPAPGPGPCPCPTPAPTP*T)-3') ;
Molecular weight formula_weight	6447.2 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E,G
Atom count atom_count	9827

ATGTGGCCAACAAGGCCTATT

Entity 2 Entity 2 polymer

Description description	;DNA (5'-D(APAPTPAPGPGPCPCPTPTPGPTPTPGPGPCPCPAPCPAP*T)-3') ;
Molecular weight formula_weight	6438.2 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F,H

AATAGGCCTTGTTGGCCACAT

Entity 3 Entity 3 polymer

Description description	Type II restriction enzyme SfiI
Molecular weight formula_weight	31273.6 kDa
EC 编号 ec_number	3.1.21.4
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,C

MHQDYRELSLDELESVEKQTLRTIVQALQQYSKEAKSIFETTAADSSGEVIVLAEDITQYALEVAETYPINRRFAGFIDYKRVRWLPSPHGLLPQVLLVDAKASTEKNRDTLQRSQLPMDAEFRNTSSGEVVTMEAGVIPHLMLQSANDGVLPAVTTSIFVHFYYRELKDVEGRYRELKSIYVLSLPHARLKQRYNPDPDTSFFGAGKHSPARGEVARIRVYFDRLKEACPWRLQELHYSADSEYTQPRWRDLNDAGHEVTKEFLFLER

Entity 4 Entity 4 non-polymer

Description description	CALCIUM ION
Molecular weight formula_weight	40.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	111

▼

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

Domain ID domain_id	2f03A01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	600 — ECO RV Endonuclease; Chain A
Homologous superfamily homologous superfamily	40 — Type II restriction enzyme SfiI, multifunctional domain

Domain ID domain_id	2f03A02
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	610 — Type II restriction enzyme SfiI, DNA-recognition domain

Domain ID domain_id	2f03C01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	600 — ECO RV Endonuclease; Chain A
Homologous superfamily homologous superfamily	40 — Type II restriction enzyme SfiI, multifunctional domain

Domain ID domain_id	2f03C02
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	610 — Type II restriction enzyme SfiI, DNA-recognition domain

▶

Unit-cell length a length_a	85.600 Å
Unit-cell length b length_b	85.600 Å
Unit-cell length c length_c	418.700 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	24

Space group space_group	P 61 2 2
Space-group number int_tables_number	178
Crystal system crystal_system	—

Resolution resolution	3.050 Å
Low-resolution limit resolution_low	50.000 Å
R factor r_factor	—
R_work r_work	0.2410
R_free r_free	0.2930

Crystal structure of tetrameric restriction endonuclease SfiI in complex with cognate DNA (partial bound form)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Type II restriction enzyme SfiI

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2f03__assembly_1__model_1

2f03__assembly_1__model_1 | I(q)

2f03__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)

Crystal structure of tetrameric restriction endonuclease SfiI in complex with cognate DNA (partial bound form)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Type II restriction enzyme SfiI

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2f03__assembly_1__model_1

2f03__assembly_1__model_1 | I(q)

2f03__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)