SAXSdb — 2fk6

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

RIBONUCLEASE Z

Bacillus subtilis

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Homooligomer	Protein 2 RNA 2	TRNA(THR) × 2 ZINC ION × 2 2-(N-MORPHOLINO)-ETHANESULFONIC ACID × 2 GLYCEROL × 2 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RNZ_BACSU
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–307； UniProt 1–307

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2fk6
Deposition date deposition_date	2006-01-04
Structure title title	Crystal Structure of RNAse Z/tRNA(Thr) complex
Keywords keywords	PROTEIN-tRNA COMPLEX; ZINC-DEPENDENT METAL HYDROLASE; tRNA MATURASE, HYDROLASE-RNA COMPLEX; HYDROLASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

2fk6__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

2fk6__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

2fk6__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	35.43 Å
Rg (electron density)	34.18 Å
Total Rg	34.62 Å
Atom count	7078
Residues	720
Excluded volume	118270 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`2fk6__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	TRNA(THR)
Molecular weight formula_weight	25522.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	R
Atom count atom_count	3550

GCUUCCAUAGCUCAGCAGGUAGAGCACUUCCAUGGUAAGGAAGAGGUCAGCGGUUCGAGCCCGCUUGGAAGCUUAAAUG

Entity 2 Entity 2 polymer

Description description	RIBONUCLEASE Z
Molecular weight formula_weight	35565.5 kDa
EC 编号 ec_number	3.1.26.11
Mutation mutation	I46M, L228M, H65A
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MELLFLGTGAGIPAKARNVTSVALKLLEERRSVWLFDCGEATQHQMLHTTIKPRKIEKIFITHMAGDHVYGLPGLLGSRSFQGGEDELTVYGPKGIKAFIETSLAVTKTHLTYPLAIQEIEEGIVFEDDQFIVTAVSVIHGVEAFGYRVQEKDVPGSLKADVLKEMNIPPGPVYQKIKKGETVTLEDGRIINGNDFLEPPKKGRSVVFSGDTRVSDKLKELARDCDVMVHEATFAKEDRKLAYDYYHSTTEQAAVTAKEARAKQLILTHISARYQGDASLELQKEAVDVFPNSVAAYDFLEVNVPRGKLAAALEHHHHHH

Source Source

Source organism organism	Bacillus subtilis
NCBI taxonomy ID ncbi_taxonomy_id	1423
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 4 Entity 4 non-polymer

Description description	2-(N-MORPHOLINO)-ETHANESULFONIC ACID
Molecular weight formula_weight	195.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 non-polymer

Description description	GLYCEROL
Molecular weight formula_weight	92.1 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	11

▼

6. Fold Classification (SCOP + CATH) 2 domains

SCOP 2.08 (1 domains)

Domain ID domain_id	d2fk6a1
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.157 — Metallo-hydrolase/oxidoreductase
Superfamily Superfamily superfamily	d.157.1 — Metallo-hydrolase/oxidoreductase
Family Family family	d.157.1.7 — RNase Z-like

CATH v4.4 (1 domains)

Domain ID domain_id	2fk6A00
Class class	3 — Alpha Beta
Architecture architecture	60 — 4-Layer Sandwich
Topology topology	15 — Metallo-beta-lactamase; Chain A
Homologous superfamily homologous superfamily	10 — Ribonuclease Z/Hydroxyacylglutathione hydrolase-like

▶

Unit-cell length a length_a	173.540 Å
Unit-cell length b length_b	42.400 Å
Unit-cell length c length_c	110.430 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	121.42 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	2.900 Å
Low-resolution limit resolution_low	47.120 Å
R factor r_factor	0.2510
R_work r_work	0.2500
R_free r_free	0.2990

Crystal Structure of RNAse Z/tRNA(Thr) complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

RIBONUCLEASE Z

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2fk6__assembly_1__model_1

2fk6__assembly_1__model_1 | I(q)

2fk6__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 2 domains

SCOP 2.08 (1 domains)

CATH v4.4 (1 domains)

7. Citations (2)

Crystal Structure of RNAse Z/tRNA(Thr) complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

RIBONUCLEASE Z

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2fk6__assembly_1__model_1

2fk6__assembly_1__model_1 | I(q)

2fk6__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 2 domains

SCOP 2.08 (1 domains)

CATH v4.4 (1 domains)

7. Citations (2)