SAXSdb — 2iy3

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Signal recognition particle protein,Signal recognition particle 54 kDa protein

Sulfolobus solfataricus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Heteromer	Protein 2 RNA 1	4.5S RNA × 1 SIGNAL SEQUENCE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	A0A0E3MG81_SULSF
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 297–432； UniProt 297–432

Signal recognition particle protein,Signal recognition particle 54 kDa protein

Sulfolobus solfataricus

UniProt O07347

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Heteromer	Protein 2 RNA 1	4.5S RNA × 1 SIGNAL SEQUENCE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SRP54_THEAQ
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–296； UniProt 1–296

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2iy3
Deposition date deposition_date	2006-07-12
Structure title title	Structure of the E. Coli Signal Regognition Particle
Keywords keywords	RNA-BINDING, RNA-BINDING PROTEIN COMPLEX, SIGNAL RECOGNITION PARTICLE; RNA-BINDING
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

2iy3__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

2iy3__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

2iy3__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	42.03 Å
Rg (electron density)	35.72 Å
Total Rg	35.47 Å
Atom count	110
Residues	110
Excluded volume	62178 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`2iy3__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	Signal recognition particle protein,Signal recognition particle 54 kDa protein
Molecular weight formula_weight	48274.1 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	559

MFQQLSARLQEAIGRLRGRGRITEEDLKATLREIRRALMDADVNLEVARDFVERVREEALGKQVLESLTPAEVILATVYEALKEALGGEARLPVLKDRNLWFLVGLQGSGKTTTAAKLALYYKGKGRRPLLVAADTQRPAAREQLRLLGEKVGVPVLEVMDGESPESIRRRVEEKARLEARDLILVDTAGRLQIDEPLMGELARLKEVLGPDEVLLVLDAMTGQEALSVARAFDEKVGVTGLVLTKLDGDARGGAALSARHVTGKPIYFAGVSEKPEGLEPFYPERLAGRILGMGDIESILEKVKGLEEYDKIQKKMEDVMEGKGKLTLRDVYAQIIALRKMGPLSKVLQHIPGLGIMLPTPSEDQLKIGEEKIRRWLAALNSMTYKELENPNIIDKSRMRRIAEGSGLEVEEVRELLEWYNNMNRLLKMVK

Source Source

Source organism organism	Sulfolobus solfataricus
NCBI taxonomy ID ncbi_taxonomy_id	2287
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	4.5S RNA
Molecular weight formula_weight	35547.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B

GGGGGCUCUGUUGGUUCUCCCGCAACGCUACUCUGUUUACCAGGUCAGGUCCGAAAGGAAGCAGCCAAGGCAGAUGACGCGUGUGCCGGGAUGUAGCUGGCAGGGCCCCC

Entity 3 Entity 3 polymer

Description description	SIGNAL SEQUENCE
Molecular weight formula_weight	1380.6 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C

AALALAAAAALALAAAG

▼

6. Fold Classification (SCOP + CATH) 2 domains

SCOP 2.08 (2 domains)

Domain ID domain_id	d2iy3a1
Class class	a — All alpha proteins
Fold Fold fold	a.24 — Four-helical up-and-down bundle
Superfamily Superfamily superfamily	a.24.13 — Domain of the SRP/SRP receptor G-proteins
Family Family family	a.24.13.1 — Domain of the SRP/SRP receptor G-proteins

Domain ID domain_id	d2iy3a2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.37 — P-loop containing nucleoside triphosphate hydrolases
Superfamily Superfamily superfamily	c.37.1 — P-loop containing nucleoside triphosphate hydrolases
Family Family family	c.37.1.10 — Nitrogenase iron protein-like

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	1

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	16.000 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	16.00 Å
Resolution测定Method resolution_method	PROJECTION MATCHING
颗粒数 num_particles	24382

Structure of the E. Coli Signal Regognition Particle

1. Protein Identity and Related Structures Protein Identity & Related Structures

Signal recognition particle protein,Signal recognition particle 54 kDa protein

State in the Current Structure

Other States of the Same Protein in the Database

Signal recognition particle protein,Signal recognition particle 54 kDa protein

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2iy3__assembly_1__model_1

2iy3__assembly_1__model_1 | I(q)

2iy3__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

6. Fold Classification (SCOP + CATH) 2 domains

SCOP 2.08 (2 domains)

7. Citations (1)

Structure of the E. Coli Signal Regognition Particle

1. Protein Identity and Related Structures Protein Identity & Related Structures

Signal recognition particle protein,Signal recognition particle 54 kDa protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Signal recognition particle protein,Signal recognition particle 54 kDa protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2iy3__assembly_1__model_1

2iy3__assembly_1__model_1 | I(q)

2iy3__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

6. Fold Classification (SCOP + CATH) 2 domains

SCOP 2.08 (2 domains)

7. Citations (1)