2pe5

Crystal Structure of the Lac Repressor bound to ONPG in repressed state

Method: X-RAY DIFFRACTION D_max: 168.9 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Lactose operon repressor

Escherichia coli

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 2 DNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 2–331 Chain B； UniProt 2–331	Fragment：sequence database residues 2-331 Mutation：S61L	;DNA (5'-D(DAPDAPDTPDTPDGPDTPDGPDAPDGPDCPDGPDCPDTPDCPDAPDCPDAPDAPDTPDT)-3') ; × 2 145 2-nitrophenyl beta-D-galactopyranoside × 2	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 7.5；281 K；1.8 M Ammonium Sulfate, 0.1 M Hepes pH 7.5. 11% PEG 400, 14% glycerol, 10X ONPG, VAPOR DIFFUSION, HANGING DROP, temperature 281K	Resolution 3.50 Å R-free 0.287
2	Protein–DNA Homooligomer Protein × 2 DNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain C； UniProt 2–331	Fragment：sequence database residues 2-331 Mutation：S61L	;DNA (5'-D(DAPDAPDTPDTPDGPDTPDGPDAPDGPDCPDGPDCPDTPDCPDAPDCPDAPDAPDTPDT)-3') ; × 2 145 2-nitrophenyl beta-D-galactopyranoside × 2	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 7.5；281 K；1.8 M Ammonium Sulfate, 0.1 M Hepes pH 7.5. 11% PEG 400, 14% glycerol, 10X ONPG, VAPOR DIFFUSION, HANGING DROP, temperature 281K	Resolution 3.50 Å R-free 0.287

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 2PE5	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1CJG NMR STRUCTURE OF LAC REPRESSOR HP62-DNA COMPLEX Deposited 1999-04-14	Different construct Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–62（62 aa） Fragment：HEADPIECE, RESIDUES 1 - 62 Chain B 1–62（62 aa） Fragment：HEADPIECE, RESIDUES 1 - 62	Not recorded	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6.1；315 K；Ionic strength (raw mmCIF value) SEE ARTICLE；Pressure 1 NMR sample composition SEE ARTICLE	Resolution not provided
1EFA CRYSTAL STRUCTURE OF THE LAC REPRESSOR DIMER BOUND TO OPERATOR AND THE ANTI-INDUCER ONPF Deposited 2000-02-07	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–333（333 aa） Fragment：RESIDUES 1-333 Chain B 1–333（333 aa） Fragment：RESIDUES 1-333	Mutation：ALA109THR Mutation：ALA109THR	NPF 2-nitrophenyl beta-D-fucopyranoside × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；298 K；ammonium sulfate, PEG 400, HEPES, Glycerol, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K	Resolution 2.60 Å R-free 0.264
1EFA CRYSTAL STRUCTURE OF THE LAC REPRESSOR DIMER BOUND TO OPERATOR AND THE ANTI-INDUCER ONPF Deposited 2000-02-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 1–333（333 aa） Fragment：RESIDUES 1-333	Mutation：ALA109THR	NPF 2-nitrophenyl beta-D-fucopyranoside × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；298 K；ammonium sulfate, PEG 400, HEPES, Glycerol, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K	Resolution 2.60 Å R-free 0.264
1JWL Structure of the Dimeric lac Repressor/Operator O1/ONPF Complex Deposited 2001-09-04	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–333（333 aa） Fragment：C-terminal deletion mutant Chain B 1–333（333 aa） Fragment：C-terminal deletion mutant	Not recorded	NPF 2-nitrophenyl beta-D-fucopyranoside × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；295 K；ammonium sulfate, PEG400, HEPES, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 4.00 Å R-free 0.261
1JWL Structure of the Dimeric lac Repressor/Operator O1/ONPF Complex Deposited 2001-09-04	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 1–333（333 aa） Fragment：C-terminal deletion mutant	Not recorded	NPF 2-nitrophenyl beta-D-fucopyranoside × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；295 K；ammonium sulfate, PEG400, HEPES, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 4.00 Å R-free 0.261
1JYE Structure of a Dimeric Lac Repressor with C-terminal Deletion and K84L Substitution Deposited 2001-09-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–349（349 aa） Fragment：C-TERMINAL DELETION MUTANT	Mutation：YES	GOL GLYCEROL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.6；295 K；Sodium Acetate, Sodium Citrate, pH 5.6, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 1.70 Å R-free 0.241
1JYF Structure of the Dimeric Lac Repressor with an 11-residue C-terminal Deletion. Deposited 2001-09-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–349（349 aa） Fragment：C-TERMINAL DELETION	Not recorded	GOL GLYCEROL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.6；295 K；Sodium Citrate, Sodium Acetate, pH 5.6, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 3.00 Å R-free 0.252
1L1M SOLUTION STRUCTURE OF A DIMER OF LAC REPRESSOR DNA-BINDING DOMAIN COMPLEXED TO ITS NATURAL OPERATOR O1 Deposited 2002-02-19	Different construct Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–62（62 aa） Fragment：N-terminal DNA-binding domain, Residues 1-62 Chain B 1–62（62 aa） Fragment：N-terminal DNA-binding domain, Residues 1-62	Mutation：V52C Mutation：V52C	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6；315 K；Ionic strength (raw mmCIF value) 10mM KPi, 20mM KCl；Pressure ambient NMR sample composition 2mM Lac-HP62-V52C U-15N,13C, 10mM KPi, 20mM KCl, 90% H2O, 10% D2O \| 90% H2O/10% D2O	Resolution not provided
1LBG LACTOSE OPERON REPRESSOR BOUND TO 21-BASE PAIR SYMMETRIC OPERATOR DNA, ALPHA CARBONS ONLY Deposited 1996-01-03	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–360（360 aa） Chain B 1–360（360 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 4.80 Å
1LBG LACTOSE OPERON REPRESSOR BOUND TO 21-BASE PAIR SYMMETRIC OPERATOR DNA, ALPHA CARBONS ONLY Deposited 1996-01-03	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain C 1–360（360 aa） Chain D 1–360（360 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 4.80 Å
1LBH INTACT LACTOSE OPERON REPRESSOR WITH GRATUITOUS INDUCER IPTG Deposited 1996-02-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 1–360（360 aa） Chain B 1–360（360 aa） Chain C 1–360（360 aa） Chain D 1–360（360 aa）	Not recorded	IPT 1-methylethyl 1-thio-beta-D-galactopyranoside × 4	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 3.20 Å
1LBI LAC REPRESSOR Deposited 1996-02-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 1–360（360 aa） Chain B 1–360（360 aa） Chain C 1–360（360 aa） Chain D 1–360（360 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.70 Å
1LCC STRUCTURE OF THE COMPLEX OF LAC REPRESSOR HEADPIECE AND AN 11 BASE-PAIR HALF-OPERATOR DETERMINED BY NUCLEAR MAGNETIC RESONANCE SPECTROSCOPY AND RESTRAINED MOLECULAR DYNAMICS Deposited 1993-03-25	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–51（51 aa）	Not recorded	NA SODIUM ION × 1	SOLUTION NMR mmCIF provides none of the parsed conditions	Resolution not provided
1LCD STRUCTURE OF THE COMPLEX OF LAC REPRESSOR HEADPIECE AND AN 11 BASE-PAIR HALF-OPERATOR DETERMINED BY NUCLEAR MAGNETIC RESONANCE SPECTROSCOPY AND RESTRAINED MOLECULAR DYNAMICS Deposited 1993-03-25	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–51（51 aa）	Not recorded	NA SODIUM ION × 1	SOLUTION NMR mmCIF provides none of the parsed conditions	Resolution not provided
1LQC LAC REPRESSOR HEADPIECE (RESIDUES 1-56), NMR, 32 STRUCTURES Deposited 1996-08-13	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–56（56 aa） Fragment：HEADPIECE, RESIDUES 1 - 56	Not recorded	No recorded non-water small molecule	SOLUTION NMR mmCIF provides none of the parsed conditions	Resolution not provided
1OSL Solution structure of a dimeric lactose DNA-binding domain complexed to a nonspecific DNA sequence Deposited 2003-03-20	Different construct Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–62（62 aa） Fragment：N-terminal DNA-binding domain, residues 1-62 Chain B 1–62（62 aa） Fragment：N-terminal DNA-binding domain, residues 1-62	Mutation：V52C Mutation：V52C	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 5.8；300 K；Ionic strength (raw mmCIF value) 400mM KCl, 60mM KPi；Pressure ambient NMR sample composition 2mM LAC-HP62-V52C U-15N,13C, 60mM KPI, 400mM KCL \| 90% H2O/10% D2O	Resolution not provided
1TLF UNPRECEDENTED QUATERNARY STRUCTURE OF E. COLI LAC REPRESSOR CORE TETRAMER: IMPLICATIONS FOR DNA LOOPING Deposited 1995-03-06	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 19–319（301 aa） Chain B 19–319（301 aa） Chain C 19–319（301 aa） Chain D 19–319（301 aa）	Not recorded	EMC ETHYL MERCURY ION × 4 IPT 1-methylethyl 1-thio-beta-D-galactopyranoside × 4	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.60 Å
2BJC NMR structure of a protein-DNA complex of an altered specificity mutant of the lac repressor headpiece that mimics the gal repressor Deposited 2005-02-01	Different construct Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–62（62 aa） Fragment：DNA BINDING DOMAIN, LAC HEADPIECE RESIDUES 1-62 Chain B 1–62（62 aa） Fragment：DNA BINDING DOMAIN, LAC HEADPIECE RESIDUES 1-62	Mutation：YES Mutation：YES	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6；315 K；Ionic strength (raw mmCIF value) 20；Pressure 1.0 NMR sample composition 95% WATER/5% D2O	Resolution not provided
2KEI Refined Solution Structure of a Dimer of LAC repressor DNA-Binding domain complexed to its natural operator O1 Deposited 2009-01-30	Different construct Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–62（62 aa） Fragment：UNP residues 1-62 Chain B 1–62（62 aa） Fragment：UNP residues 1-62	Mutation：V52C Mutation：V52C	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6；315 K；Ionic strength (raw mmCIF value) 0.03；Pressure ambient NMR sample composition 2 mM DNA (5'-D(DGPDAPDAPDTPDTPDGPDTPDGPDAPDGPDCPDGPDGPDAPDTPDAPDAPDCPDAPDAPDTPDTPDT)-3'), 2 mM DNA (5'-D(PDAPDAPDAPDTPDTPDGPDTPDTPDAPDTPDCPDCPDGPDCPDTPDCPDAPDCPDAPDAPDTPDTPDC)-3'), 2 mM Lac headpiece dimer, 10% D2O, 10 mM potassium phosphate, 20 mM potassium chloride, 90% H2O/10% D2O \| 90% H2O/10% D2O	Resolution not provided
2KEJ Solution structure of a dimer of LAC repressor DNA-binding domain complexed to its natural operator O2 Deposited 2009-01-30	Different construct Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–62（62 aa） Fragment：UNP residues 1-62 Chain B 1–62（62 aa） Fragment：UNP residues 1-62	Mutation：V52C Mutation：V52C	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6；315 K；Ionic strength (raw mmCIF value) 0.03；Pressure ambient NMR sample composition 0.7 mM DNA (5'-D(DGPDAPDAPDTPDTPDGPDTPDGPDAPDGPDCPDGPDGPDAPDTPDAPDAPDCPDAPDAPDTPDTPDT)'), 0.7 mM DNA (5'-D(PDAPDAPDAPDTPDTPDGPDTPDTPDAPDTPDCPDCPDGPDCPDTPDCPDAPDCPDAPDAPDTPDTPDC)'), 0.7 mM Lac headpiece dimer, 5% D2O, 10 mM potassium phosphate, 20 mM potassium chloride, 5% U-100% 2H d8-glycerol, 0.01% sodium azide, 95% H2O/5% D2O \| 95% H2O/5% D2O	Resolution not provided
2KEK Solution structure of a dimer of LAC repressor DNA-binding domain complexed to its natural operator O3 Deposited 2009-01-30	Different construct Different mutation/modification Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–62（62 aa） Fragment：UNP residues 1-62 Chain B 1–62（62 aa） Fragment：UNP residues 1-62	Mutation：V52C Mutation：V52C	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6；315 K；Ionic strength (raw mmCIF value) 0.03；Pressure ambient NMR sample composition 0.7 mM DNA (5'-strand1-3'), 0.7 mM DNA (5'-strand2-3'), 0.7 mM Lac headpiece dimer, 5% D2O, 10 mM potassium phosphate, 20 mM potassium chloride, 5% U-100% 2H d8-glycerol, 0.01% sodium azide, 95% H2O/5% D2O \| 95% H2O/5% D2O	Resolution not provided
2P9H High resolution structure of the Lactose Repressor bound to IPTG Deposited 2007-03-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 62–330（269 aa） Chain B 62–330（269 aa）	Not recorded	IPT 1-methylethyl 1-thio-beta-D-galactopyranoside × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.6；281 K；1.4 M Sodium Acetate, 0.1 M Sodium Citrate, pH 5.6, VAPOR DIFFUSION, HANGING DROP, temperature 281K	Resolution 2.00 Å R-free 0.246
2PAF Crystal Structure of the Lactose Repressor bound to anti-inducer ONPF in induced state Deposited 2007-03-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 62–330（269 aa） Chain B 62–330（269 aa）	Not recorded	NPF 2-nitrophenyl beta-D-fucopyranoside × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.6；281 K；1.4 M Sodium Acetate, 0.1 M Sodium Citrate, pH 5.6, VAPOR DIFFUSION, HANGING DROP, temperature 281K	Resolution 3.50 Å R-free 0.265
3EDC Crystal Structure of a 1.6-hexanediol Bound Tetrameric Form of Escherichia coli Lac-repressor Refined to 2.1 Resolution Deposited 2008-09-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 1–360（360 aa） Chain B 1–360（360 aa） Chain C 1–360（360 aa） Chain D 1–360（360 aa）	Not recorded	HEZ HEXANE-1,6-DIOL × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；294 K；microseeded, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 294K	Resolution 2.10 Å R-free 0.201

21 other PDB entries and 24 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	LACI_ECOLI
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–330； UniProt 2–331 Author chain B； PDBConstruct 1–330； UniProt 2–331 Author chain C； PDBConstruct 1–330； UniProt 2–331

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2pe5
Deposition date deposition_date	2007-04-02
Structure title title	Crystal Structure of the Lac Repressor bound to ONPG in repressed state
Keywords keywords	;Lac repressor, allosteric effectors, gene regulation, DNA-binding, Transcription, Transcription regulation, TRANSCRIPTION-DNA COMPLEX ;; TRANSCRIPTION/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	46.70 Å
Radius of gyration Rg (electron density) rg_electron	45.37 Å
Forward intensity I(0) i0	267343000.00
Molecular weight molecular_weight	122430.0 kDa
Excluded volume excluded_volume	148710 Å³
Envelope volume envelope_volume	226110 Å³
Hydration-shell volume shell_volume	44132 Å³
Envelope diameter envelope_diameter	167.8 Å
Shell Rg shell_rg	44.96 Å
Envelope Rg envelope_rg	48.33 Å
Shape Rg shape_rg	45.28 Å
Total Rg total_rg	45.63 Å
Total atoms total_atoms	8527
Residues n_residues	1037
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	168.9 Å
Rg (real space) rg_real	47.56 Å
Rg uncertainty (real space) rg_real_error	2.07 Å
I(0) (real space) i0_real	2.6730e+08
I(0) uncertainty (real space) i0_real_error	5.3170e+06
Rg (reciprocal space) rg_reciprocal	46.71 Å
I(0) (reciprocal space) i0_reciprocal	267100000.0000
Solution quality estimate total_estimate	0.7609
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	34.8 Å
Skewness Skewness skewness	0.618
Kurtosis Kurtosis kurtosis	-0.351
Angular range angular_range	— – 0.1700 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	11620000.0000
Real-space data points n_real_points	35
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.569; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.565; Smooth: 0.615

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	;DNA (5'-D(DAPDAPDTPDTPDGPDTPDGPDAPDGPDCPDGPDCPDTPDCPDAPDCPDAPDAPDTPDT)-3') ;
Molecular weight formula_weight	6133.0 kDa
Source method src_method	syn
Copy count entity_count	3

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D,E,F
Atom count atom_count	8527

AATTGTGAGCGCTCACAATT

Entity 2 Entity 2 polymer

Description description	Lactose operon repressor
Molecular weight formula_weight	35410.4 kDa
Mutation mutation	S61L
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C

KPVTLYDVAEYAGVSYQTVSRVVNQASHVSAKTREKVEAAMAELNYIPNRVAQQLAGKQLLLIGVATSSLALHAPSQIVAAIKSRADQLGASVVVSMVERSGVEACKAAVHNLLAQRVSGLIINYPLDDQDAIAVEAACTNVPALFLDVSDQTPINSIIFSHEDGTRLGVEHLVALGHQQIALLAGPLSSVSARLRLAGWHKYLTRNQIQPIAEREGDWSAMSGFQQTMQMLNEGIVPTAMLVANDQMALGAMRAITESGLRVGADISVVGYDDTEDSSCYIPPLTTIKQDFRLLGQTSVDRLLQLSQGQAVKGNQLLPVSLVKRKTTLA

来源 Source

来源生物 organism	Escherichia coli
NCBI Class编号 ncbi_taxonomy_id	562
宿主生物 host_organism	Escherichia coli BL21(DE3)

Entity 3 Entity 3 non-polymer

Description description	2-nitrophenyl beta-D-galactopyranoside
Molecular weight formula_weight	301.2 kDa
Source method src_method	syn
Copy count entity_count	3

▼

7. Fold Classification (SCOP + CATH) 15 domains

SCOP 2.08 (6 domains)

Domain ID domain_id	d2pe5a1
Class class	a — All alpha proteins
Fold Fold fold	a.35 — lambda repressor-like DNA-binding domains
Superfamily Superfamily superfamily	a.35.1 — lambda repressor-like DNA-binding domains
Family Family family	a.35.1.5 — GalR/LacI-like bacterial regulator

Domain ID domain_id	d2pe5a2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.93 — Periplasmic binding protein-like I
Superfamily Superfamily superfamily	c.93.1 — Periplasmic binding protein-like I
Family Family family	c.93.1.1 — L-arabinose binding protein-like

Domain ID domain_id	d2pe5b1
Class class	a — All alpha proteins
Fold Fold fold	a.35 — lambda repressor-like DNA-binding domains
Superfamily Superfamily superfamily	a.35.1 — lambda repressor-like DNA-binding domains
Family Family family	a.35.1.5 — GalR/LacI-like bacterial regulator

Domain ID domain_id	d2pe5b2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.93 — Periplasmic binding protein-like I
Superfamily Superfamily superfamily	c.93.1 — Periplasmic binding protein-like I
Family Family family	c.93.1.1 — L-arabinose binding protein-like

Domain ID domain_id	d2pe5c1
Class class	a — All alpha proteins
Fold Fold fold	a.35 — lambda repressor-like DNA-binding domains
Superfamily Superfamily superfamily	a.35.1 — lambda repressor-like DNA-binding domains
Family Family family	a.35.1.5 — GalR/LacI-like bacterial regulator

Domain ID domain_id	d2pe5c2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.93 — Periplasmic binding protein-like I
Superfamily Superfamily superfamily	c.93.1 — Periplasmic binding protein-like I
Family Family family	c.93.1.1 — L-arabinose binding protein-like

CATH v4.4 (9 domains)

Domain ID domain_id	2pe5A01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	260 — 434 Repressor (Amino-terminal Domain)
Homologous superfamily homologous superfamily	40 — lambda repressor-like DNA-binding domains

Domain ID domain_id	2pe5A02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	2300 — Response regulator

Domain ID domain_id	2pe5A03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	2300 — Response regulator

Domain ID domain_id	2pe5B01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	260 — 434 Repressor (Amino-terminal Domain)
Homologous superfamily homologous superfamily	40 — lambda repressor-like DNA-binding domains

Domain ID domain_id	2pe5B02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	2300 — Response regulator

Domain ID domain_id	2pe5B03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	2300 — Response regulator

Domain ID domain_id	2pe5C01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	260 — 434 Repressor (Amino-terminal Domain)
Homologous superfamily homologous superfamily	40 — lambda repressor-like DNA-binding domains

Domain ID domain_id	2pe5C02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	2300 — Response regulator

Domain ID domain_id	2pe5C03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	2300 — Response regulator

▶

8. Citations (1)

▶

Unit-cell length a length_a	253.080 Å
Unit-cell length b length_b	253.080 Å
Unit-cell length c length_c	203.247 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	54

Space group space_group	H 3 2
Space-group number int_tables_number	155
Crystal system crystal_system	—

Resolution resolution	3.500 Å
Low-resolution limit resolution_low	19.980 Å
R factor r_factor	0.2362
R_work r_work	0.2335
R_free r_free	0.2866

fit	/app/data/saxs_computation/pe/2pe5/2pe5.fit
pddf	/app/data/pr_computation/pe/2pe5/2pe5.pr.out
profile	/app/data/saxs_computation/pe/2pe5/2pe5.dat

Crystal Structure of the Lac Repressor bound to ONPG in repressed state

1. Protein Identity and Related Structures Protein Identity & Related Structures

Lactose operon repressor

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 non-polymer

7. Fold Classification (SCOP + CATH) 15 domains

SCOP 2.08 (6 domains)

CATH v4.4 (9 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)