SAXSdb — 2v6e

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

PROTELEMORASE

KLEBSIELLA PHAGE PHIKO2

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 2 DNA 4	TELRL × 2 TELRL × 2 VANADATE ION × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q6UAV6_9CAUD
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 21–558； UniProt 1–538 Author chain B； PDBConstruct 21–558； UniProt 1–538

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2v6e
Deposition date deposition_date	2007-07-17
Structure title title	protelomerase TelK complexed with substrate DNA
Keywords keywords	HAIRPIN TELOMERE, HYDROLASE, RESOLVASE, PROTELOMERASE, DNA DISTORTION; HYDROLASE
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

2v6e__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

2v6e__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

2v6e__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	37.97 Å
Rg (electron density)	37.38 Å
Total Rg	37.76 Å
Atom count	10082
Residues	1152
Excluded volume	172980 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`2v6e__assembly_1__model_1`	hexameric （6）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	PROTELEMORASE
Molecular weight formula_weight	64239.2 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	10082

MGSSHHHHHHSSGLVPRGSHMRKVKIGELINSLVSEVEAIDASDRPQGDKTKKIKAAALKYKNALFNDKRKFRGKGLEKRISANTFNSYMSRARKRFDDRLHHNFEKNVIKLSEKYPLYSEELSSWLSMPAASIRQHMSRLQAKLKEIMPLAEDLSNIKIGTKNSEAKINKLANKYPEWQFAISDLNSEDWKDKRDYLYKLFQQGSSLLEDLNNLKVNHEVLYHLQLSSAERTSIQQRWANVLSEKKRNVVVIDYPRYMQAIYDIINKPIVSFDLTTRRGMAPLAFALAALSGRRMIEIMLQGEFSVAGKYTVTFLGQAKKRSEDKGISRKIYTLCDATLFVSLVNELRSCPAAADFDEVIKGYGENDTRSENGRINAILATAFNPWVKTFLGDDRRVYKDSRAIYARIAYEMFFRVDPRWKNVDEDVFFMEILGHDDENTQLHYKQFKLANFSRTWRPNVGEENARLAALQKLDSMMPDFARGDAGVRIHETVKQLVEQDPSIKITNSTLRPFNFSTRLIPRYLEFAADALGQFVGENGQWQLKDEAPAIVLPDEEI

Source Source

Source organism organism	KLEBSIELLA PHAGE PHIKO2
NCBI taxonomy ID ncbi_taxonomy_id	255431
Host organism host_organism	ESCHERICHIA COLI

Entity 2 Entity 2 polymer

Description description	TELRL
Molecular weight formula_weight	7770.0 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C,E

CGCGCGTATAATGGGCAATTGTGTG

Entity 3 Entity 3 polymer

Description description	TELRL
Molecular weight formula_weight	5732.8 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D,F

CACACAATTGCCCATTATA

Entity 4 Entity 4 non-polymer

Description description	VANADATE ION
Molecular weight formula_weight	114.9 kDa
Source method src_method	syn
Copy count entity_count	2

▼

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

Domain ID domain_id	2v6eA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	287 — Helix Hairpins
Homologous superfamily homologous superfamily	3180 —

Domain ID domain_id	2v6eA02
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	1440 — de novo design (two linked rop proteins)
Homologous superfamily homologous superfamily	270 —

Domain ID domain_id	2v6eA03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	30 — Telomere resolvase

Domain ID domain_id	2v6eA04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	2040 —

Domain ID domain_id	2v6eB01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	287 — Helix Hairpins
Homologous superfamily homologous superfamily	3180 —

Domain ID domain_id	2v6eB02
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	1440 — de novo design (two linked rop proteins)
Homologous superfamily homologous superfamily	270 —

Domain ID domain_id	2v6eB03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	30 — Telomere resolvase

Domain ID domain_id	2v6eB04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	2040 —

▶

Unit-cell length a length_a	157.973 Å
Unit-cell length b length_b	157.973 Å
Unit-cell length c length_c	90.842 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 41
Space-group number int_tables_number	76
Crystal system crystal_system	—

Resolution resolution	3.200 Å
Low-resolution limit resolution_low	50.000 Å
R factor r_factor	0.2554
R_work r_work	0.2554
R_free r_free	0.2860

protelomerase TelK complexed with substrate DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

PROTELEMORASE

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2v6e__assembly_1__model_1

2v6e__assembly_1__model_1 | I(q)

2v6e__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

7. Citations (1)

protelomerase TelK complexed with substrate DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

PROTELEMORASE

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2v6e__assembly_1__model_1

2v6e__assembly_1__model_1 | I(q)

2v6e__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

7. Citations (1)