SAXSdb — 3ho1

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

argonaute

Thermus thermophilus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Monomer	Protein 1 DNA 1 RNA 1	5'-D(PTPGPAPGPGPTPAPGPTPAPGPGPTPTPGPTPAPTAPGPT)-3' × 1 5'-R(PCPCPUPAPCPUPAPCPCPUPCP*G)-3' × 1 MAGNESIUM ION × 1 water × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q746M7_THET2
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–685； UniProt 1–685

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3ho1
Deposition date deposition_date	2009-06-01
Structure title title	Crystal structure of T. thermophilus Argonaute N546 mutant protein complexed with DNA guide strand and 12-nt RNA target strand
Keywords keywords	argonaute, protein-DNA-RNA complex, NUCLEIC ACID BINDING PROTEIN-DNA-RNA COMPLEX; NUCLEIC ACID BINDING PROTEIN/DNA/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3ho1__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3ho1__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3ho1__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	28.59 Å
Rg (electron density)	28.25 Å
Total Rg	28.87 Å
Atom count	5674
Residues	700
Excluded volume	99252 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3ho1__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	argonaute
Molecular weight formula_weight	76727.8 kDa
Mutation mutation	D546N
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	5767

MNHLGKTEVFLNRFALRPLNPEELRPWRLEVVLDPPPGREEVYPLLAQVARRAGGVTVRMGDGLASWSPPEVLVLEGTLARMGQTYAYRLYPKGRRPLDPKDPGERSVLSALARRLLQERLRRLEGVWVEGLAVYRREHARGPGWRVLGGAVLDLWVSDSGAFLLEVDPAYRILCEMSLEAWLAQGHPLPKRVRNAYDRRTWELLRLGEEDPKELPLPGGLSLLDYHASKGRLQGREGGRVAWVADPKDPRKPIPHLTGLLVPVLTLEDLHEEEGSLALSLPWEERRRRTREIASWIGRRLGLGTPEAVRAQAYRLSIPKLMGRRAVSKPADALRVGFYRAQETALALLRLDGAQGWPEFLRRALLRAFGASGASLRLHTLHAHPSQGLAFREALRKAKEEGVQAVLVLTPPMAWEDRNRLKALLLREGLPSQILNVPLREEERHRWENALLGLLAKAGLQVVALSGAYPAELAVGFDAGGRESFRFGGAACAVGGDGGHLLWTLPEAQAGERIPQEVVWDLLEETLWAFRRKAGRLPSRVLLLRNGRVPQDEFALALEALAREGIAYDLVSVRKSGGGRVYPVQGRLADGLYVPLEDKTFLLLTVHRDFRGTPRPLKLVHEAGDTPLEALAHQIFHLTRLYPASGFAFPRLPAPLHLADRLVKEVGRLGIRHLKEVDREKLFFV

Source Source

Source organism organism	Thermus thermophilus
NCBI taxonomy ID ncbi_taxonomy_id	262724
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	5'-D(PTPGPAPGPGPTPAPGPTPAPGPGPTPTPGPTPAPTAPGP*T)-3'
Molecular weight formula_weight	6588.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	X

TGAGGTAGTAGGTTGTATAGT

Entity 3 Entity 3 polymer

Description description	5'-R(PCPCPUPAPCPUPAPCPCPUPCPG)-3'
Molecular weight formula_weight	3708.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	Y

CCUACUACCUCG

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	93

▼

6. Fold Classification (SCOP + CATH) 5 domains

CATH v4.4 (5 domains)

Domain ID domain_id	3ho1A01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	530 — Alpha-D-Glucose-1,6-Bisphosphate; Chain A, domain 4
Homologous superfamily homologous superfamily	60 —

Domain ID domain_id	3ho1A02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	2620 —

Domain ID domain_id	3ho1A03
Class class	2 — Mainly Beta
Architecture architecture	170 — Beta Complex
Topology topology	260 — paz domain
Homologous superfamily homologous superfamily	50 —

Domain ID domain_id	3ho1A04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	3ho1A05
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	2300 — Response regulator

▶

Unit-cell length a length_a	122.928 Å
Unit-cell length b length_b	118.531 Å
Unit-cell length c length_c	59.533 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	114.91 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	2.600 Å
Low-resolution limit resolution_low	30.000 Å
R factor r_factor	—
R_work r_work	0.2200
R_free r_free	0.2580

Crystal structure of T. thermophilus Argonaute N546 mutant protein complexed with DNA guide strand and 12-nt RNA target strand

1. Protein Identity and Related Structures Protein Identity & Related Structures

argonaute

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3ho1__assembly_1__model_1

3ho1__assembly_1__model_1 | I(q)

3ho1__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 5 domains

CATH v4.4 (5 domains)

7. Citations (1)

Crystal structure of T. thermophilus Argonaute N546 mutant protein complexed with DNA guide strand and 12-nt RNA target strand

1. Protein Identity and Related Structures Protein Identity & Related Structures

argonaute

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3ho1__assembly_1__model_1

3ho1__assembly_1__model_1 | I(q)

3ho1__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 5 domains

CATH v4.4 (5 domains)

7. Citations (1)