SAXSdb — 3rw6

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Nuclear RNA export factor 1

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	constitutive transport element(CTE)of Mason-Pfizer monkey virus RNA × 1 water × 2	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 1	constitutive transport element(CTE)of Mason-Pfizer monkey virus RNA × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	NXF1_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–267； UniProt 96–362 Author chain B； PDBConstruct 1–267； UniProt 96–362

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3rw6
Deposition date deposition_date	2011-05-07
Structure title title	Structure of nuclear RNA export factor TAP bound to CTE RNA
Keywords keywords	;retroviral constitutive transport element (CTE), RNA recognition motif (RRM), leucine-rich repeat (LRR) motif, TRANSPORT PROTEIN-RNA complex ;; TRANSPORT PROTEIN/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3rw6__assembly_2__model_1

Assembly 2 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3rw6__assembly_2__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3rw6__assembly_2__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	24.49 Å
Rg (electron density)	24.22 Å
Total Rg	24.85 Å
Atom count	3316
Residues	304
Excluded volume	54266 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3rw6__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`3rw6__assembly_2__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	Nuclear RNA export factor 1
Molecular weight formula_weight	30509.9 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	6786

VRRDRAPPERGGAGTSQDGTSKNWFKITIPYGRKYDKAWLLSMIQSKCSVPFTPIEFHYENTRAQFFVEDASTASALKAVNYKILDRENRRISIIINSSAPPHTILNELKPEQVEQLKLIMSKRYDGSQQALDLKGLRSDPDLVAQNIDVVLNRRSCMAATLRIIEENIPELLSLNLSNNRLYRLDDMSSIVQKAPNLKILNLSGNELKSERELDKIKGLKLEELWLDGNSLCDTFRDQSTYISAIRERFPKLLRLDGHELPPPIAF

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	constitutive transport element(CTE)of Mason-Pfizer monkey virus RNA
Molecular weight formula_weight	20285.0 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	H,F

GGCACUAACCUAAGACAGGAGGGCCGGGAAACCUGCCUAAUCCAAUGACGGGUAAUAGUGUC

Entity 3 Entity 3 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	135

▼

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

Domain ID domain_id	3rw6A01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	330 — RRM (RNA recognition motif) domain

Domain ID domain_id	3rw6A02
Class class	3 — Alpha Beta
Architecture architecture	80 — Alpha-Beta Horseshoe
Topology topology	10 — Leucine-rich repeat, LRR (right-handed beta-alpha superhelix)
Homologous superfamily homologous superfamily	10 — Ribonuclease Inhibitor

Domain ID domain_id	3rw6B01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	330 — RRM (RNA recognition motif) domain

Domain ID domain_id	3rw6B02
Class class	3 — Alpha Beta
Architecture architecture	80 — Alpha-Beta Horseshoe
Topology topology	10 — Leucine-rich repeat, LRR (right-handed beta-alpha superhelix)
Homologous superfamily homologous superfamily	10 — Ribonuclease Inhibitor

▶

Unit-cell length a length_a	55.412 Å
Unit-cell length b length_b	117.048 Å
Unit-cell length c length_c	84.773 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	106.40 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.300 Å
Low-resolution limit resolution_low	37.866 Å
R factor r_factor	0.2059
R_work r_work	0.2033
R_free r_free	0.2563

Structure of nuclear RNA export factor TAP bound to CTE RNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Nuclear RNA export factor 1

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3rw6__assembly_2__model_1

3rw6__assembly_2__model_1 | I(q)

3rw6__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 water

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)

Structure of nuclear RNA export factor TAP bound to CTE RNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Nuclear RNA export factor 1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3rw6__assembly_2__model_1

3rw6__assembly_2__model_1 | I(q)

3rw6__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 water

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)