SAXSdb — 4ang

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

COAT PROTEIN

PSEUDOMONAS PHAGE PRR1

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Homooligomer	Protein 180 RNA 120	;5'-R(CPCPAPUPAPAPGPGPAPGPCPUPAPCP CPUPAPUPGPGP)-3' ; × 120 CALCIUM ION × 60	Consistent with all polymers
2	Protein–RNA	Homooligomer	Protein 3 RNA 2	;5'-R(CPCPAPUPAPAPGPGPAPGPCPUPAPCP CPUPAPUPGPGP)-3' ; × 2 CALCIUM ION × 1	Consistent with all polymers
3	Protein–RNA	Homooligomer	Protein 15 RNA 10	;5'-R(CPCPAPUPAPAPGPGPAPGPCPUPAPCP CPUPAPUPGPGP)-3' ; × 10 CALCIUM ION × 5	Consistent with all polymers
4	Protein–RNA	Homooligomer	Protein 18 RNA 12	;5'-R(CPCPAPUPAPAPGPGPAPGPCPUPAPCP CPUPAPUPGPGP)-3' ; × 12 CALCIUM ION × 6	Consistent with all polymers
5	Protein–RNA	Homooligomer	Protein 3 RNA 2	;5'-R(CPCPAPUPAPAPGPGPAPGPCPUPAPCP CPUPAPUPGPGP)-3' ; × 2 CALCIUM ION × 1	Consistent with all polymers
6	Protein–RNA	Homooligomer	Protein 360 RNA 240	;5'-R(CPCPAPUPAPAPGPGPAPGPCPUPAPCP CPUPAPUPGPGP)-3' ; × 240 CALCIUM ION × 120	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	COAT_BPPRR
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–131； UniProt 1–131 Author chain B； PDBConstruct 1–131； UniProt 1–131 Author chain C； PDBConstruct 1–131； UniProt 1–131

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4ang
Deposition date deposition_date	2012-03-16
Structure title title	Small RNA phage PRR1 in complex with an RNA operator fragment
Keywords keywords	VIRUS, CAPSID, CAPSID PROTEINS, IONS, METALS; VIRUS
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4ang__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4ang__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4ang__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	0.00 Å
Rg (electron density)	125.60 Å
Total Rg	125.40 Å
Atom count	216420
Residues	25200
Excluded volume	3739300 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4ang__assembly_1__model_1`	300-MERIC （300）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`4ang__assembly_2__model_1`	pentameric （5）	Excluded	—	—
	Exclusion reason： Auxiliary symmetry representation; not a complete or representative biological assembly.
3	1	`4ang__assembly_3__model_1`	25-meric （25）	Excluded	—	—
	Exclusion reason： Auxiliary symmetry representation; not a complete or representative biological assembly.
4	1	`4ang__assembly_4__model_1`	30-meric （30）	Excluded	—	—
	Exclusion reason： Auxiliary symmetry representation; not a complete or representative biological assembly.
5	1	`4ang__assembly_5__model_1`	pentameric （5）	Excluded	—	—
	Exclusion reason： Auxiliary symmetry representation; not a complete or representative biological assembly.
6	1	`4ang__assembly_6__model_1`	600-meric （600）	Excluded	—	—
	Exclusion reason： Auxiliary symmetry representation; not a complete or representative biological assembly.

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	COAT PROTEIN
Molecular weight formula_weight	14568.5 kDa
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C
Atom count atom_count	3863

AQLQNLVLKDREATPNDHTFVPRDIRDNVGEVVESTGVPIGESRFTISLRKTSNGRYKSTLKLVVPVVQSQTVNGIVTPVVVRTSYVTVDFDYDARSTTKERNNFVGMIADALKADKMLVHDTIVNLQGVY

Source Source

Source organism organism	PSEUDOMONAS PHAGE PRR1
NCBI taxonomy ID ncbi_taxonomy_id	12024
Host organism host_organism	ESCHERICHIA COLI

Entity 2 Entity 2 polymer

Description description	;5'-R(CPCPAPUPAPAPGPGPAPGPCPUPAPCP CPUPAPUPGPGP)-3' ;
Molecular weight formula_weight	6406.9 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	R,S

CCAUAAGGAGCUACCUAUGG

Entity 3 Entity 3 non-polymer

Description description	CALCIUM ION
Molecular weight formula_weight	40.1 kDa
Source method src_method	syn
Copy count entity_count	1

▼

6. Fold Classification (SCOP + CATH) 3 domains

CATH v4.4 (3 domains)

Domain ID domain_id	4angA00
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	380 — MS2 Viral Coat Protein
Homologous superfamily homologous superfamily	10 — MS2 Viral Coat Protein

Domain ID domain_id	4angB00
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	380 — MS2 Viral Coat Protein
Homologous superfamily homologous superfamily	10 — MS2 Viral Coat Protein

Domain ID domain_id	4angC00
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	380 — MS2 Viral Coat Protein
Homologous superfamily homologous superfamily	10 — MS2 Viral Coat Protein

▶

Unit-cell length a length_a	281.300 Å
Unit-cell length b length_b	285.400 Å
Unit-cell length c length_c	472.900 Å
Unit-cell angle α angle_alpha	93.23 °
Unit-cell angle β angle_beta	90.03 °
Unit-cell angle γ angle_gamma	119.45 °
Molecules per unit cell Z z_pdb	360

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.500 Å
Low-resolution limit resolution_low	29.980 Å
R factor r_factor	0.3080
R_work r_work	0.3080
R_free r_free	0.3130

Small RNA phage PRR1 in complex with an RNA operator fragment

1. Protein Identity and Related Structures Protein Identity & Related Structures

COAT PROTEIN

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4ang__assembly_1__model_1

4ang__assembly_1__model_1 | I(q)

4ang__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

6. Fold Classification (SCOP + CATH) 3 domains

CATH v4.4 (3 domains)

7. Citations (1)

Small RNA phage PRR1 in complex with an RNA operator fragment

1. Protein Identity and Related Structures Protein Identity & Related Structures

COAT PROTEIN

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4ang__assembly_1__model_1

4ang__assembly_1__model_1 | I(q)

4ang__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

6. Fold Classification (SCOP + CATH) 3 domains

CATH v4.4 (3 domains)

7. Citations (1)