SAXSdb — 4fyd

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase alpha catalytic subunit A

Saccharomyces cerevisiae

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Monomer Protein × 1 DNA 2 PDB declaration: trimeric（3） Consistent with all polymer counts	Chain A； UniProt 349–1258	Fragment：Polymerase domain, UNP residues 349-1258 Mutation：R508A, N509A, D998N	;DNA (5'-D(TPGPAPGPCPGPTPGTPGPTPAPCPCPCPCPTPGPCPCPCPGPCPCPG)-3') ; × 1 ;DNA/RNA (5'-R(CPGPGPCPGPGPGPCPAPG)-D(PGPG)-3') ; × 1 DGT* 2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions：MICROBATCH；291 K；0.2M MgAc2, 10% PEG8000, microbatch, temperature 291K	Resolution 3.10 Å R-free 0.247
2	Protein–DNA Monomer Protein × 1 DNA 2 PDB declaration: trimeric（3） Consistent with all polymer counts	Chain B； UniProt 349–1258	Fragment：Polymerase domain, UNP residues 349-1258 Mutation：R508A, N509A, D998N	;DNA (5'-D(TPGPAPGPCPGPTPGTPGPTPAPCPCPCPCPTPGPCPCPCPGPCPCPG)-3') ; × 1 ;DNA/RNA (5'-R(CPGPGPCPGPGPGPCPAPG)-D(PGPG)-3') ; × 1 DGT* 2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions：MICROBATCH；291 K；0.2M MgAc2, 10% PEG8000, microbatch, temperature 291K	Resolution 3.10 Å R-free 0.247

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 4FYD	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
3FLO Crystal structure of the carboxyl-terminal domain of yeast DNA polymerase alpha in complex with its B subunit Deposited 2008-12-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 3 PDB declaration: trimeric	Chain B 1263–1468（206 aa） Fragment：Cysteine-rich C-terminal domain, UNP residues 1263-1468	Not recorded	SO4 SULFATE ION × 19 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；291 K；0.1M MES, 1.26M Ammonium Sulfate, 3mM TCEP, pH6.0, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.50 Å R-free 0.218
3FLO Crystal structure of the carboxyl-terminal domain of yeast DNA polymerase alpha in complex with its B subunit Deposited 2008-12-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 3 PDB declaration: trimeric	Chain D 1263–1468（206 aa） Fragment：Cysteine-rich C-terminal domain, UNP residues 1263-1468	Not recorded	SO4 SULFATE ION × 15 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；291 K；0.1M MES, 1.26M Ammonium Sulfate, 3mM TCEP, pH6.0, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.50 Å R-free 0.218
3FLO Crystal structure of the carboxyl-terminal domain of yeast DNA polymerase alpha in complex with its B subunit Deposited 2008-12-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein heterocomplex Heteromer；Protein × 3 PDB declaration: trimeric	Chain F 1263–1468（206 aa） Fragment：Cysteine-rich C-terminal domain, UNP residues 1263-1468	Not recorded	SO4 SULFATE ION × 16 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；291 K；0.1M MES, 1.26M Ammonium Sulfate, 3mM TCEP, pH6.0, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.50 Å R-free 0.218
3FLO Crystal structure of the carboxyl-terminal domain of yeast DNA polymerase alpha in complex with its B subunit Deposited 2008-12-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 4 Protein heterocomplex Heteromer；Protein × 3 PDB declaration: trimeric	Chain H 1263–1468（206 aa） Fragment：Cysteine-rich C-terminal domain, UNP residues 1263-1468	Not recorded	SO4 SULFATE ION × 15 ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；291 K；0.1M MES, 1.26M Ammonium Sulfate, 3mM TCEP, pH6.0, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.50 Å R-free 0.218
3OIQ Crystal structure of yeast telomere protein Cdc13 OB1 and the catalytic subunit of DNA polymerase alpha Pol1 Deposited 2010-08-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain B 215–250（36 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；277 K；23% PEG3350, 0.2M Magnisium formate, 0.1M Tris-HCl, 5mM DTT, pH 8.0, VAPOR DIFFUSION, SITTING DROP, temperature 277K	Resolution 2.40 Å R-free 0.273
4B08 Yeast DNA polymerase alpha, Selenomethionine protein Deposited 2012-06-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 349–1258（910 aa） Fragment：POLYMERASE DOMAIN, RESIDUES 349-1258	Non-standard monomer：Yes (specific site not provided by mmCIF)	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 9.4；0.1 M BICINE PH 8.0-9.4, 6-10% PEG 8000	Resolution 2.67 Å R-free 0.234
4C93 Crystal structure of the carboxy-terminal domain of yeast Ctf4 bound to Pol alpha. Deposited 2013-10-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 5 PDB declaration: pentameric	Chain D 137–149（13 aa） Fragment：CTF4-BINDING MOTIF, RESIDUES 137-149 Chain E 137–149（13 aa） Fragment：CTF4-BINDING MOTIF, RESIDUES 137-149	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions 0.2 M TRI-SODIUM CITRATE PH 6.2, 7-9% PEG 8000	Resolution 2.69 Å R-free 0.210
4FVM Crystal structure of yeast DNA polymerase alpha Deposited 2012-06-29	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 349–1258（910 aa） Fragment：Polymerase domain, UNP residues 349-1258	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 9.4；291 K；0.1M Bicine, 6% PEG8000, pH 9.4, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.30 Å R-free 0.236
4FXD Crystal structure of yeast DNA polymerase alpha bound to DNA/RNA Deposited 2012-07-03	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: trimeric	Chain A 349–1258（910 aa） Fragment：Polymerase domain, UNP residues 349-1258	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；291 K；0.1 M Bicine, 12% PEG3350, 10 mM MgCl2, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 3.00 Å R-free 0.285
4FXD Crystal structure of yeast DNA polymerase alpha bound to DNA/RNA Deposited 2012-07-03	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: trimeric	Chain B 349–1258（910 aa） Fragment：Polymerase domain, UNP residues 349-1258	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；291 K；0.1 M Bicine, 12% PEG3350, 10 mM MgCl2, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 3.00 Å R-free 0.285
8B9A S. cerevisiae replisome + Ctf4, bound by pol alpha primase. Complex engaged with a fork DNA substrate containing a 60 nucleotide lagging strand. Deposited 2022-10-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 21 PDB declaration: 23-meric	Chain J 1–1468（1468 aa）	Not recorded	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 4 MG MAGNESIUM ION × 4 ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.50 Å
8B9B S. cerevisiae replisome + Ctf4, bound by pol alpha. Complex engaged with a fork DNA substrate containing a 60 nucleotide lagging strand. Deposited 2022-10-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 21 PDB declaration: 23-meric	Chain J 1–1468（1468 aa）	Not recorded	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 4 MG MAGNESIUM ION × 4 ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.50 Å
8B9C S. cerevisiae pol alpha - replisome complex Deposited 2022-10-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 18 PDB declaration: eicosameric	Chain J 1–1468（1468 aa）	Not recorded	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 4 MG MAGNESIUM ION × 4 ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.60 Å

9 other PDB entries and 13 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	DPOA_YEAST
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–910； UniProt 349–1258 Author chain B； PDBConstruct 1–910； UniProt 349–1258

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4fyd
Deposition date deposition_date	2012-07-04
Structure title title	Crystal structure of yeast DNA polymerase alpha bound to DNA/RNA and dGTP
Keywords keywords	DNA polymerase, DNA replication, TRANSFERASE-DNA complex; TRANSFERASE/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	42.86 Å
Radius of gyration Rg (electron density) rg_electron	43.45 Å
Forward intensity I(0) i0	730591000.00
Molecular weight molecular_weight	211370.0 kDa
Excluded volume excluded_volume	259890 Å³
Envelope volume envelope_volume	363290 Å³
Hydration-shell volume shell_volume	68149 Å³
Envelope diameter envelope_diameter	148.0 Å
Shell Rg shell_rg	49.88 Å
Envelope Rg envelope_rg	42.54 Å
Shape Rg shape_rg	43.46 Å
Total Rg total_rg	43.69 Å
Total atoms total_atoms	29108
Residues n_residues	1752
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	140.6 Å
Rg (real space) rg_real	42.84 Å
Rg uncertainty (real space) rg_real_error	1.26 Å
I(0) (real space) i0_real	7.3060e+08
I(0) uncertainty (real space) i0_real_error	1.3450e+07
Rg (reciprocal space) rg_reciprocal	42.86 Å
I(0) (reciprocal space) i0_reciprocal	730600000.0000
Solution quality estimate total_estimate	0.8921
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	45.6 Å
Skewness Skewness skewness	0.283
Kurtosis Kurtosis kurtosis	-0.583
Angular range angular_range	— – 0.1850 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	100100000.0000
Real-space data points n_real_points	38
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.895; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 1.000; Smooth: 0.910

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	DNA polymerase alpha catalytic subunit A
Molecular weight formula_weight	103401.7 kDa
EC 编号 ec_number	2.7.7.7
Mutation mutation	R508A, N509A, D998N
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	29108

TDTFQMFWLDYCEVNNTLILFGKVKLKDDNCVSAMVQINGLCRELFFLPREGKTPTDIHEEIIPLLMDKYGLDNIRAKPQKMKYSFELPDIPSESDYLKVLLPYQTPKSSRDTIPSDLSSDTFYHVFGGNSNIFESFVIQNRIMGPCWLDIKGADFNSIAAASHCAVEVSVDKPQNITPTTTKTMPNLRCLSLSIQTLMNPKENKQEIVSITLSAYRNISLDSPIPENIKPDDLCTLVRPPQSTSFPLGLAALAKQKLPGRVRLFNNEKAMLSCFCAMLKVEDPDVIIGHRLQNVYLDVLAHRMHDLNIPTFSSIGRRLRRTWPEKFGRGNSNMNHFFISDICSGRLICDIANEMGQSLTPKCQSWDLSEMYQVTCEKEHKPLDIDYQNPQYQNDVNSMTMALQENITNCMISAEVSYRIQLLTLTKQLTNLAGNAWAQTLGGTRAGRNEYILLHEFSRNGFIVPDKEGNRSRAQKQRQNEENADAPVNSKKAKYQGGLVFEPEKGLHKNYVLVMDFNSLYPSIIQEFNICFTTVDRNKEDIDELPSVPPSEVDQGVLPRLLANLVDRRREVKKVMKTETDPHKRVQCDIRQQALKLTANSMYGCLGYVNSRFYAKPLAMLVTNKGREILMNTRQLAESMNLLVVYGDTNSVMIDTGCDNYADAIKIGLGFKRLVNERYRLLEIDIDNVFKKLLLHAKKKYAALTVNLDKNGNGTTVLEVKGLDMKRREFCPLSRDVSIHVLNTILSDKDPEEALQEVYDYLEDIRIKVETNNIRIDKYKINMKLSKDPKAYPGGKNMPAVQVALRMRKAGRVVKAGSVITFVITKQDEIDNAADTPALSVAERAHALNEVMIKSNNLIPDPQYYLEKQIFAPVERLLERIDSFNVVRLSEALGLDSKKYFRREGGNNNG

来源 Source

来源生物 organism	Saccharomyces cerevisiae
通用名 common_name	;Baker's yeast ;
NCBI Class编号 ncbi_taxonomy_id	559292
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	;DNA (5'-D(TPGPAPGPCPGPTPGTPGPTPAPCPCPCPCPTPGPCPCPCPGPCPCP*G)-3') ;
Molecular weight formula_weight	7627.9 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C,D

TGAGCGTGTGTACCCCTGCCCGCCG

Entity 3 Entity 3 polymer

Description description	;DNA/RNA (5'-R(CPGPGPCPGPGPGPCPAPG)-D(PGPG)-3') ;
Molecular weight formula_weight	3929.4 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide/polyribonucleotide hybrid
Chain IDs strand_id	E,F

CGGCGGGCAGGG

Entity 4 Entity 4 non-polymer

Description description	2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	507.2 kDa
Source method src_method	syn
Copy count entity_count	2

▼

7. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

Domain ID domain_id	4fydA01
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	730 —

Domain ID domain_id	4fydA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	2820 —

Domain ID domain_id	4fydA03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	4fydA05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	132 — Topoisomerase I; Chain A, domain 4
Homologous superfamily homologous superfamily	60 — B family DNA polymerase, thumb domain

Domain ID domain_id	4fydB01
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	730 —

Domain ID domain_id	4fydB02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	2820 —

Domain ID domain_id	4fydB03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	4fydB05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	132 — Topoisomerase I; Chain A, domain 4
Homologous superfamily homologous superfamily	60 — B family DNA polymerase, thumb domain

▶

8. Citations (1)

▶

Unit-cell length a length_a	111.689 Å
Unit-cell length b length_b	145.686 Å
Unit-cell length c length_c	197.199 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	3.100 Å
Low-resolution limit resolution_low	48.801 Å
R factor r_factor	0.2116
R_work r_work	0.2098
R_free r_free	0.2467

fit	/app/data/saxs_computation/fy/4fyd/4fyd.fit
pddf	/app/data/pr_computation/fy/4fyd/4fyd.pr.out
profile	/app/data/saxs_computation/fy/4fyd/4fyd.dat

Crystal structure of yeast DNA polymerase alpha bound to DNA/RNA and dGTP

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase alpha catalytic subunit A

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

7. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)