SAXSdb — 4gcw

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Ribonuclease Z

Bacillus subtilis subsp. subtilis

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	TRNA(THR) × 1 ZINC ION × 2 2-(N-MORPHOLINO)-ETHANESULFONIC ACID × 1 water × 2	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 1	TRNA(THR) × 1 ZINC ION × 2 2-(N-MORPHOLINO)-ETHANESULFONIC ACID × 1 water × 2	Consistent with all polymers
3	Protein–RNA	Homooligomer	Protein 2 RNA 2	TRNA(THR) × 2 ZINC ION × 4 2-(N-MORPHOLINO)-ETHANESULFONIC ACID × 2 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RNZ_BACSU
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–307； UniProt 1–307

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4gcw
Deposition date deposition_date	2012-07-31
Structure title title	Crystal structure of RNase Z in complex with precursor tRNA(Thr)
Keywords keywords	ZINC-DEPENDENT METALO BETALACTAMASE - RNA COMPLEX, TRNA MATURASE, PROTEIN-RNA COMPLEX, TRNA BINDING, HYDROLASE-RNA complex; HYDROLASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4gcw__assembly_2__model_1

Assembly 2 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4gcw__assembly_2__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4gcw__assembly_2__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	32.38 Å
Rg (electron density)	32.25 Å
Total Rg	32.55 Å
Atom count	3586
Residues	360
Excluded volume	59802 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4gcw__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`4gcw__assembly_2__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
3	1	`4gcw__assembly_3__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Ribonuclease Z
Molecular weight formula_weight	35632.6 kDa
EC 编号 ec_number	3.1.26.11
Mutation mutation	I46M, L228M
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	3618

MELLFLGTGAGIPAKARNVTSVALKLLEERRSVWLFDCGEATQHQMLHTTIKPRKIEKIFITHMHGDHVYGLPGLLGSRSFQGGEDELTVYGPKGIKAFIETSLAVTKTHLTYPLAIQEIEEGIVFEDDQFIVTAVSVIHGVEAFGYRVQEKDVPGSLKADVLKEMNIPPGPVYQKIKKGETVTLEDGRIINGNDFLEPPKKGRSVVFSGDTRVSDKLKELARDCDVMVHEATFAKEDRKLAYDYYHSTTEQAAVTAKEARAKQLILTHISARYQGDASLELQKEAVDVFPNSVAAYDFLEVNVPRGKLAAALEHHHHHH

Source Source

Source organism organism	Bacillus subtilis subsp. subtilis
NCBI taxonomy ID ncbi_taxonomy_id	224308
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	TRNA(THR)
Molecular weight formula_weight	24597.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B

GCUUCCAUAGCUCAGCAGGUAGAGCACUUCCAUGGUAAGGAAGAGGUCAGCGGUUCGAGCCCGCUUGGAAGCUUAA

Entity 3 Entity 3 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 4 Entity 4 non-polymer

Description description	2-(N-MORPHOLINO)-ETHANESULFONIC ACID
Molecular weight formula_weight	195.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	32

▼

6. Fold Classification (SCOP + CATH) 1 domains

CATH v4.4 (1 domains)

Domain ID domain_id	4gcwA00
Class class	3 — Alpha Beta
Architecture architecture	60 — 4-Layer Sandwich
Topology topology	15 — Metallo-beta-lactamase; Chain A
Homologous superfamily homologous superfamily	10 — Ribonuclease Z/Hydroxyacylglutathione hydrolase-like

▶

Unit-cell length a length_a	174.080 Å
Unit-cell length b length_b	42.550 Å
Unit-cell length c length_c	110.890 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	127.18 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	3.000 Å
Low-resolution limit resolution_low	43.300 Å
R factor r_factor	0.2284
R_work r_work	0.2269
R_free r_free	0.2564

Crystal structure of RNase Z in complex with precursor tRNA(Thr)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Ribonuclease Z

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4gcw__assembly_2__model_1

4gcw__assembly_2__model_1 | I(q)

4gcw__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 1 domains

CATH v4.4 (1 domains)

7. Citations (1)

Crystal structure of RNase Z in complex with precursor tRNA(Thr)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Ribonuclease Z

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4gcw__assembly_2__model_1

4gcw__assembly_2__model_1 | I(q)

4gcw__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 1 domains

CATH v4.4 (1 domains)

7. Citations (1)